Koraal Zee

 

 

TOESTAND  IN 2013  /RAPPORT   : de oceanen

2217665[1]oceanen 2013  <— pdf De Morgen

1.- Koraalschade

2.- Koraal en biodiversiteit

Koraalschade

 

koraalrif en biodiversiteit

 

 

Cabo Pulmo National Marine Park : Baja California State, Mexico.

Tropische koraalriffen ;

* Bij een kritische watertemperatuur sterven de symbiotische algen, waar koraal van afhankelijk is. Dit leidt tot zogenoemde koraalverbleking. Als extreme hitte zich vaak achter elkaar herhaald, kan koraal hierdoor afsterven.

*(2010)Koraalriffen voor de noordwestkust van Indonesië die in 2004 de tsunami overleefden, sterven nu op grote schaal uit door de stijgende temperatuur van het zeewater.

De Wildlife Conservation Society (WCS) stuurde in mei 2010 zeebiologen naar de provincie Atjeh, op het puntje van Sumatra, die daar watertemperaturen van 34 graden maten, vier graden hoger dan het langetermijngemiddelde. Door de hoge temperatuur verdwijnen uit het koraal veel eencellige algen, die van levensbelang zijn voor het rif. Met de algen verdwijnt ook de kleur van het koraal, een proces dat verbleking wordt genoemd. Tachtig procent van dit verbleekte koraal in Atjeh is inmiddels reeds afgestorven.

* De riffen hebben in het verleden getoond dat ze zich snel kunnen herstellen , maar het zijn daarom nog geen garanties voor een omkering van de trend ;

-Als gevolg van de tsunami in 2004 stierf een derde van het koraalrif voor Atjeh af, maar het rif wist hiervan vlug te herstellen. Des te verontrustender vinden wetenschappers het dat het rif goed weet te reageren op moeilijke omstandigheden, maar de bedreiging door de hoge watertemperatuur ogenschijnlijk zo groot is, dat het koraal hier geen antwoord op heeft.

* De riffen worden bovendien bedreigd door verzuring van de oceanen, waardoor de kalkstructuren oplossen.De groei neemt af door de verzuring, een gevolg van het toenemende hoeveelheid CO2 in het water.Bovendien tast overbevissing de koraalriffen aan.

* Met het verdwijnen van koraalriffen verliezen veel vissoorten hun kraamkamer.

Tsunami coral dying due to temperature rise

Bronmateriaal:
Tsunami coral dying due to temperature rise” – Telegraph.co.uk

http://www.scientias.nl/indonesisch-koraal-bezwijkt/14717

Indonesisch koraal bezwijkt

 19 augustus 2010  

Het koraal voor de kust van Indonesië overleefde in 2004 een alles verwoestende tsunami. Maar nu dreigt het steeds warmer wordende water dit dappere koraal de kop te gaan kosten. Door de opwarming van het zeewater verdwijnen algen en verzwakt het koraal. Volgens de onderzoekers zou zo’n tachtig procent van het koraal inmiddels zijn bezweken.

In mei was het water voor de kust 34 graden Celsius, zo’n vier graden Celsius warmer dan de gemiddeldes die over een lange tijdsperiode zijn vastgesteld. Juist in deze warme maand zochten wetenschappers het koraal op. Het bleek sterk verbleekt te zijn.

Bleek
Die verbleking ontstaat doordat algen die het koraal van een mooi kleurtje voorzien allemaal verdwenen zijn. De algen worden door de hitte overactief en vergiftigen het koraal waar ze te gast zijn. Door het vertrek van de algen raakt het koraal een voedselbron kwijt en verzwakt.

Snel
Volgens de onderzoekers is inmiddels zo’n 80 procent van het koraal dood. Het lijkt erop dat de koralen sneller dan ooit het loodje leggen. In het verleden kwam de verbleking van koralen ook voor, maar ging het proces een stuk langzamer.

Tragedie
“Dit is een tragedie,” vindt onderzoeker Caleb McClennen. “Niet alleen voor de biodiversiteit in de koralen, maar ook voor de mensen in de buurt.” Veel Indonesiërs verdienen hun geld dankzij toeristen die zeer geïnteresseerd zijn in de koralen. “Het is een teleurstellende ontwikkeling,” vindt ook expert Stuart Campbell. “Vooral omdat deze koralen veerkrachtig genoeg waren om andere verstoringen in het ecosysteem te boven te komen.”

Dat het proces zo snel verloopt, heeft volgens de onderzoekers alles te maken met het steeds warmer wordende zeewater. Dat laatste is deels te wijten aan de verandering van het klimaat.

Naast de Coral sea zijn er nog verschillende erg belangrijke grote koraalriffen netwerken ;

– De zogeheten Koraaldriehoek, een netwerk van riffen tussen Indonesië, de Filippijnen en Nieuw-Guinea, dreigt door klimaatverandering volledig te verdwijnen

De koraalriffen van Zuidoost-Azië bevatten een uitzonderlijk hoge concentratie biodiversiteit, met maar liefst 76 procent van alle koraalsoorten en 35 procent van alle koraalvissen, die wereldwijd worden gevonden.

* Volgens deskundigen va de VN betekent het verdwijnen van koraal in Zuid Oost azie een ‘volledig instorten’ van de wereldwijde visserij, onder voortzetting van de huidige trends.

“Maar als het koraal echt verdwijnt, bedreigt dat wereldwijd de inkomstenbronnen van zo’n 500 miljoen mensen”, zei onderzoekster Lubchenco.

Vooral in Zuidoost-Azië en rond de Indische Oceaan leven veel mensen van de koraalriffen. Dat varieert van toerisme tot visvangst. Zonder riffen zijn kustgebieden bovendien minder beschermd tegen hoge golven.

Het Wereld Natuur Fonds, dat zich baseert op een overzicht van 300 wetenschappelijke publicaties, stelde in 2009 al dat de riffen binnen 100 jaar zullen afsterven, tenzij radicale actie word ondernomen Maar die prognose is nu achterhaald als veel te optimistisch

(2011) =koraalriffen kunnen in 2050 van de zeebodem zijn verdwenen.

*Het koraal kampt met steeds warmer zeewater, dat ook steeds zuurder wordt.

* Ook scheepvaart en kustbebouwing bedreigen de kleurrijke onderzeese levende structuren die zijn opgebouwd door levende koraalpoliepen.en dito eervan afhankelijke ecologische systemen

-(2010) De voorspelde toename van de CO2-concentratie tot 450 parts per million (ppm) in het jaar 2050 zal koraal voorbij het punt van afsterven brengen. In de volgende decennia zullen waarschijnlijk alle soorten uitsterven, zegt een internationale onderzoeksgroep van 24 koraalexperts, verbonden aan diverse universiteiten en overheden.
-De oceanen absorberen grote hoeveelheden CO2 die vrijkomen door de consumptie van fossiele brandstoffen. Maar bij dat proces vindt verzuring van het oceaanwater plaats.

-Allerlei organismen die kalkskeletjes maken, zoals schelpdieren, koraal en verschillende soorten plankton, hebben toenemende moeite te overleven in het nieuwe, zure milieu.

(2010: zie hieronder voor het volledige artikel ) -“Als wij toestaan dat het CO2-niveau de 450 ppm bereikt, wat tot nog toe wordt gezien als het meest optimistische scenario voor Kopenhagen, zullen we ’s werelds koraalriffen al op het pad van degradatie en uiteindelijk uitsterven hebben gebracht”, zo zegt John Veron, een Australische mariene bioloog.

Volgens de internationale Londense onderzoeksgroep van 24 koraalexperts, verbonden aan diverse universiteiten en overheden., is 320 ppm de uiterste veilige grens voor koraal – en vormt een concentratie van 360 ppm het breekpunt.

De huidige CO2-concentratie ligt echter al in de buurt van de 390 ppm en stijgt bovendien elk jaar met 2,1 volumedelen CO2.

(2011) ”Alle bedreigingen van de koraalriffen komen nu samen”, zei Jane Lubchenco, bestuurder van de National Oceanic and Atmospheric Administration (NOAA) woensdag in Washington bij een presentatie van haar studie naar de toekomst van de riffen.

*Volgens het rapport is ruim 90 procent van alle tropische riffen in 2030 bedreigd. In 2050 zou dat gelden voor de volle 100 % . Vooral de opwarming van de zee leidt tot steeds blekere koraal.

http://green.blogs.nytimes.com/2011/02/24/deeper-peril-for-coral-reefs/?ref=science

°

09/07/08
Eén derde koraalriffen verdwenen tegen 2050
°
De oceanen verzuren zo snel dat halverwege deze eeuw een derde van de koraalriffen zal sterven.
De oceanen verzuren omdat ze het broeikasgas CO2 opnemen.
Dat blijkt uit een nieuwe studie die verschijnt in het gereputeerde magazine Science.Ook overbevissing, ontwikkeling van kustgebieden en de opwarming van de aarde spelen een rol bij het verdwijnen van koraal.
Tot 1998 waren 13 van de 704 koraalsoorten bedreigd.
Dat aantal is nu opgelopen tot 231, concluderen de wetenschappers.De onderzoekers stellen dat als niets aan de uitstoot van CO2 wordt gedaan, al het koraal zal verdwijnen.
Een kwart van de dieren in de oceanen zijn afhankelijk van koraalriffen.
Als het koraal verdwijnt, zullen die ook uitsterven, verwachten de onderzoekers. (mvl)
°
11/07/08
Vijfde koralen is dood
°
Al negentien procent van de koralen op onze planeet is gestorven. Dat maakte het IUCN (International Union for Conservation of Nature) bekend op de tiende dag van de klimaatconferentie in het Poolse Poznan. Daar moet een basis gelegd worden voor een plan dat de uitstoot van CO2 zo snel mogelijk moet terugdringen. Als dat niet gebeurt, zullen ook de resterende koralen de komende 20 tot 40 jaar verloren gaan.
°
Hoop
°
Over de hele wereld hebben de koraalriffen fel te lijden onder de opwarming van het zeewater.(1)
Bovendien neemt ook de zuurtegraad van de oceanen toe, omdat de CO2 nu eenmaal ergens terecht moet komen. Niet alleen de koralen komen hierdoor in gevaar, ook het rijke leven rond deze kleurenpracht dreigt ten onder te gaan. Maar volgens het IUCN is het nog niet te laat. Ongeveer 45 procent van de koralen blijkt nog steeds gezond te zijn en sommige koralen passen zich aan nadat ze verbleken door het warmere water.Zware klappen
Maar de laatste vier jaar hebben de koralen zware klappen gekregen. Oorzaken zijn de toenemende druk van de mens, de uitbraak van koraalziektes, meer verbleking en ook de tsunami van 2004 had ernstige gevolgen. “Als we nu niets doen, kunnen we onze koraalriffen verliezen”, zegt Clive Wilkinson van het Global Coral Reef Monitoring Network. “We weten dat koralen kunnen herstellen in een warmer klimaat. Maar we moeten ze een kans geven om zo weinig mogelijk te lijden onder andere factoren”, zegt Dr. David Obura van IUCN.Planet Watch
Ongeveer een half miljard mensen zijn afhankelijk van koraalriffen. Ze zijn een bron van voedsel, vormen een beschermende buffer langs de kust en zijn een belangrijke toeristische bron van inkomsten
Ook HLN.BE en Planet Watch zullen hun steentje bijdragen om deze verborgen schoonheid in onze oceanen te redden.
Samen met het WWF steunen we een project in Australië.
°
(1)……New research by a team from the Australian Institute of Marine Science, has found that coral reefs off the western shores of the Australian continent are not only not suffering from the increased temperature, but are apparently thriving, as the study they’ve published in Science describes, they have actually been growing faster in the past hundred years than prior to that time.Read more at: http://phys.org/news/2012-02-c…

°

Coral reef thriving in sediment-laden waters
Rapid rates of coral reef growth have been identified in sediment-laden marine environments, conditions previously believed to be detrimental to reef growth. A new study has established that Middle Reef – part of Australia’s iconic Great Barrier Reef – has grown more rapidly than many other reefs in areas with lower levels of sediment stress.

http://www.sciencedaily.com/re…

°

Tegenwoordig zijn er zo’n 4500 soorten “koraal ” bekend
(vergelijk met =tot de zoogdieren ( de huidige heersende groep ) worden ruim 5500 soorten gerekend )

°

(1 bis)

–>veel  “Koralen “zijn    wél gevoelig voor temperatuurveranderingen  / er bestaan  zelfs koralen in Noordelijke (vooralsnog ) koude wateren ……

—> Het is trouwens verkeerd om te spreken over  “Koralen “en daar conclusies aan te verbinden die voor alle koralen zouden  gelden

—> Bovendien duurt het  vele  eeuwen voor koraafriffen  zijn  opgebouwd  …..

°
10/12/08

Nieuwste onderzoek voorziet volledig uitsterven koraal

7 juli 2010

Toenemend zure oceanen en verder stijgende watertemperaturen zullen tegen het eind van deze eeuw koraalriffen wereldwijd de das omdoen, zo wijst nieuw onderzoek uit

De voorspelde toename van de CO2-concentratie tot 450 parts per million (ppm) in het jaar 2050 zal koraal voorbij het punt van afsterven brengen.

In de volgende decennia zullen waarschijnlijk alle soorten uitsterven, zegt een internationale onderzoeksgroep van 24 koraalexperts, verbonden aan diverse universiteiten en overheden

De keuken staat in brand en het vuur verspreidt zich door het huis”, zegt Alex Rogers van de Zoological Society of London. “Als we snel en besluitvaardig in actie komen, kunnen we het misschien nog blussen voor de schade onomkeerbaar wordt.”

Zuurder water

De oceanen absorberen grote hoeveelheden CO2 die vrijkomen door de consumptie van fossiele brandstoffen. Maar bij dat proces vindt verzuring van het oceaanwater plaats.

Allerlei organismen die kalkskeletjes maken, zoals schelpdieren, koraal en verschillende soorten plankton, hebben toenemende moeite te overleven in het nieuwe, zure milieu.

Congres

Tijdens een groot wetenschapscongres in maart, waarvan de conclusies twee weken geleden zijn gepubliceerd, hebben 2.500 klimaatexperts wereldleiders opgeroepen dergelijke ecologische bedreigingen sterker mee te wegen tijdens de onderhandelingen in Kopenhagen, waar tijdens de grote klimaattop in december dit jaar over uitstootverlagingen wordt beslist.

“Als wij toestaan dat het CO2-niveau de 450 ppm bereikt, wat tot nog toe wordt gezien als het meest optimistische scenario voor Kopenhagen, zullen we ’s werelds koraalriffen al op het pad van degradatie en uiteindelijk uitsterven hebben gebracht”, zo zegt John Veron, een Australische mariene bioloog

Breekpunt

Volgens de onderzoeksgroep, die gisteren in Londen bijeenkwam, is 320 ppm de uiterste veilige grens voor koraal – en vormt een concentratie van 360 ppm het breekpunt.

De huidige CO2-concentratie ligt echter al in de buurt van de 390 ppm en stijgt bovendien elk jaar met 2,1 volumedelen CO2.

Met het uitsterven van koraal verdwijnen ecosystemen met de hoogste biodiversiteit. Veel vissen zullen bovendien hun kraamkamer kwijtraken als de riffen desintegreren

°

Wetenschappers gaan koraalcellen bewaren

http://www.nu.nl/wetenschap/2314821/wetenschappers-gaan-koraalcellen-bewaren.html

18 augustus 2010

Amerikaanse wetenschappers gaan cellen van koraal bevriezen en bewaren voor later.

De ‘koraalbank’ is nodig om bedreigde soorten in de toekomst opnieuw te kunnen laten groeien.

Dat meldde een woordvoerder van het Hawaiï Instituut voor Mariene Biologie woensdag.

In de vriezer wordt onder meer sperma van koraal opgeslagen. Dat kan worden ontdooid om later gebruikt te worden bij het herstel van populaties. Ook embryonale cellen van bijvoorbeeld het paddenstoelkoraal zitten in de koraalbank.

Koraalbank

De onderzoekers hopen snel veel cellen van Hawaïaans koraal te verzamelen. De inhoud van de koraalbank kan jarenlang goed blijven.

De koraalriffen van Hawaï worden ernstig bedreigd. Dat komt onder meer door vervuiling en door het vissen met dynamiet. ”Tenzij we nu actie ondernemen kunnen de koraalriffen en de dieren die daarvan afhankelijk zijn, binnen veertig jaar verdwijnen”, aldus de onderzoekers.

°

http://www.nu.nl/wetenschap/2315066/koraal-indonesie-sterft-zeer-snel-af.html

18 augustus 2010

Koraalriffen voor de noordwestkust van Indonesië die in 2004 de tsunami overleefden, sterven nu op grote schaal uit door de stijgende temperatuur van het zeewater. Dat hebben natuurbeschermers woensdag gezegd. Ze waarschuwden dat ook andere koraalriffen elders in Azië bedreigd worden.

De Wildlife Conservation Society (WCS) stuurde in mei zeebiologen naar de provincie Atjeh, op het puntje van Sumatra, die daar watertemperaturen van 34 graden maten, vier graden hoger dan het langetermijngemiddelde. De stijgende temperatuur weten zij aan de wereldwijde opwarming van de aarde.

Eencellige algen

Door de hoge temperatuur verdwenen uit het koraal veel eencellige algen, die van levensbelang zijn voor het rif. Met de algen verdwijnt ook de kleur van het koraal, een proces dat verbleking wordt genoemd. Tachtig procent van dit verbleekte koraal is inmiddels afgestorven. “Dit is niet slechts een tragedie voor een koraalrif met een van de grootste biodiversiteiten in de wereld, maar ook voor mensen in de regio”, zei Caleb McClennen van WCS.

Moeilijke omstandigheden

Veel kustbewoners zijn voor hun dagelijkse brood afhankelijk van het rijke zeeleven en de toeristen die door het koraal worden aangetrokken. Als gevolg van de tsunami in 2004 stierf een derde van het koraalrif voor Atjeh af, maar het rif wist hiervan vlug te herstellen. Des te verontrustender vinden wetenschappers het dat het rif goed weet te reageren op moeilijke omstandigheden, maar de bedreiging door de hoge watertemperatuur ogenschijnlijk zo groot is, dat het koraal hier geen antwoord op heeft.

© Novum

_
°
Koraal Grote Oceaan verdwijnt sneller dan gedacht’

AP augustus 2007


Het koraal in de Grote Oceaan verdwijnt in een veel hoger tempo dan voorheen werd aangenomen, mede door klimaatverandering, ziektes en een falend beheer.
Dat is de conclusie van een woensdag verschenen onderzoek van de Amerikaanse Universiteit van North Carolina.

De onderzoekers, die zesduizend studies, die tussen 1968 en 2004 werden uitgevoerd, met elkaar vergeleken, kwamen tot de conclusie dat het koraal in de Aziatische Indo-Pacifische strook –
die grofweg loopt van Sumatra tot Frans-Polynesië en goed is voor 75 procent van al het koraal op de wereld – de afgelopen twintig jaar met 20 procent is afgenomen.

Vanaf de jaren zestig is in totaal bijna duizend vierkante kilometer aan koraalriffen afgestorven, aldus onderzoekers John Bruno en Elizabeth Selig.
En de schade is net zo erg aan het goed beschermde Australische Groot Barrièrerif als aan nauwelijks beheerde riffen in de Filipijnen.

Koraal vervult een belangrijke economische, culturele en ecologische rol in de landen waar het voor de kusten voorkomt.
Het biedt niet alleen een leefomgeving aan veel dier- en plantensoorten, maar ook een natuurlijke bescherming voor bijvoorbeeld veel eilandgemeenschappen.
De geschatte opbrengst van koraal bedraagt bijna 200 duizend euro per vierkante kilometer, voornamelijk door toerisme en visserij.

Hoewel het huidige onderzoek de oorzaak van de terugloop niet heeft onderzocht, geeft John Bruno de stijgende watertemperaturen door klimaatverandering en lozing van schadelijke stoffen uit landbouw en industrie
de schuld. Ook natuurlijke factoren als stormschade, de toename van het aantal koraalparasieten zoals de doornenkroon-zeester en koraalziektes zoals ‘White syndrome’ spelen volgens hem een rol.

Volgens Bruno toont het onderzoek aan dat een beter beheer van riffen nodig is in combinatie met het wegnemen van bedreigende elementen zoals overbevissing.
Echter, lokale maatregelen halen weinig uit als er op wereldschaal niets wordt gedaan aan het terugdringen van de uitstoot van broeikasgassen, zeggen de onderzoekers

‘Restauratie beschadigde koraalriffen mogelijk’?
20 april 2007

Het is mogelijk om beschadigde koraalriffen in de wereldzeeën te restaureren.
Dat concluderen ruim 150 experts op het gebied van koralen, die deze week in Burgers’ Zoo in Arnhem bijeen zijn voor het eerste internationale koralencongres.
Op enkele kleine stukjes koraal op diverse plaatsen ter wereld wordt al geoefend.

Koraal wordt ernstig bedreigd door toerisme, vervuiling en klimaatverandering.
Eén simpele aanraking kan jaren groei ongedaan maken, zo kwetsbaar is koraal.
Daarom is het niet verwonderlijk dat schepen die met hun sleepnetten over het koraal trekken en vissers die dynamietbommen gebruiken vaak onherstelbare schade aanbrengen.

30 procent niet meer te redden
Bijna 30 procent van de koraalriffen is al zo beschadigd dat het als verloren beschouwd kan worden, zo meldt de site van het Wereld Natuur Fonds.

Als het zo doorgaat, komt daar de komende decennia nog eens 30 procent bij.
Dit brengt het totaal op een 60 procent.
Koraalriffen vormen natuurlijke buffers voor kusten.
Als de riffen zouden verdwijnen zou dat een ecologische en economische ramp zijn, aldus de koraalexperts in Arnhem.

De kennis over het behoud van koralen is de laatste jaren snel toegenomen, omdat diverse dierentuinen koraalriffen in aquaria hebben aangelegd.
Het is de bedoeling dat er voor koralen net als voor allerlei zoogdiersoorten een internationaal fokprogramma komt om uitsterven te voorkomen, zegt Bas Lukkenaar van Burgers’ Zoo.

Halve centimeter per jaar
De koralenexperts verwachten dat eeuwenoude riffen in zee te herstellen zijn door stukken gekweekt en gekloond koraal te laten aangroeien.
Dat zal een tijdje duren, want koralen groeien erg langzaam, ongeveer een halve centimeter per jaar.
Met name in Japan, Nederland en de Verenigde Staten is er veel kennis over het kweken en klonen van koraal.

°

Burgers Zoo
http://burgerszoo.nl.colo2.netmasters06.netmasters.nl/

Wat u moet weten over de Coral Sea

Het rif aan de noordoostkust van Australië strekt het zich uit over een lengte van meer dan tweeduizend kilometer. Er wonen dertig soorten walvissen, dolfijnen, bruinvissen en met uitsterven bedreigde zeekoeien.

Allemaal beesjes
Maar liefst zes verschillende soorten zeeschildpadden komen er zich voortplanten. In de mangroves aan de kust gedijt de zoutwaterkrokodil. Het rif herbergt 125 soorten haaien, roggen en zeekatten. Er werden al meer dan 5.000 soorten weekdieren ontdekt, negen soorten zeepaardjes, zeven soorten kikkers, 17 soorten zeeslangen en 49 soorten zeenaalden.

Op de eilandjes wonen 215 soorten vogels tussen 2.195 soorten planten. Tussen meer dan 400 soorten koraal zwemmen 1.500 soorten visjes, waaronder de hele cast uit Finding Nemo.

Donkere wolken
Het Great Barrier Reef en de Coral Sea lijden niet alleen onder toenemend toerisme en overbevissing – de wateren van de Coral Sea zijn de kweekplaats van vissen die 1,1 miljard mensen in Azië en Oceanië voeden. Global warming is misschien nog de donkerste wolk die boven het rif hangt. Een rapport van WWF toont aan dat tegen 2050 minder dan 5 procent van het Great Barrier Reef zal overblijven als de wereld er niet in slaagt om de CO2-uitstoot te verminderen.

Zuurder
Om dat te verklaren moeten we even technisch worden. Kooldioxide of CO2 lost makkelijk op in water en vormt dan koolzuur, en de oceanen nemen nu zo veel kooldioxide op dat ze steeds zuurder worden. Die verzuring leidt tot een daling van het aantal bouwsteentjes waarvan koralen en andere zeeedieren hun harde skeletten maken.

KOOLZUUR <–


Verbleken

Bovendien verbleekt het koraal doordat het zeewater zo warm wordt dat de koralen de symbiotische algen afstoten die ze nodig hebben om te overleven. In twee jaar tijd, in 1997 en 1998 stierf daardoor 16 procent van alle koralen op aarde. Meer dan 20 procent van de koraalriffen op aarde zijn nu al zodanig beschadigd door klimaatverandering, vervuiling, destructieve vistechnieken dat ze niet hersteld kunnen worden.

Koralen zien wereldwijd pips

 20 juli 2010  2

Wetenschappers hebben ontdekt dat koraalriffen wereldwijd – onder meer ten zuidoosten van Azië, in de Indische Oceaan en in de Stille Oceaan – wit worden. Deze verbleking van het koraal treedt op doordat de kleurrijke algen die het koraal van oudsher een kleurtje geven, door de riffen worden afgestoten.

De wetenschappers hebben met behulp van duikers enorme gebieden in kaart gebracht waar het koraal letterlijk wat pipsjes ziet. Er zijn verschillende riffen die er slecht aan toe zijn. Zo heeft de verbleking rondom de Maldiven zijn tol geëist en dreigt ook het koraal in het Caribisch gebied wit te worden.

Verloren
De wetenschappers vermoeden dat het witte koraal te wijten is aan de hoge watertemperaturen van dit jaar. In 1998 was het water ook al zo warm en daardoor ging zo’n zestien procent van alle koraalriffen verloren. “Dit is een enorm gebeuren en we zullen een hoop koralen zien sterven,” voorspelt wetenschapper Mark Eakin.

Bleekjes
De verbleking van het koraal treedt op wanneer de watertemperaturen minimaal één graad hoger zijn dan normaal. Men vermoedt dat de hoge temperaturen ervoor zorgen dat algen overactief worden en het koraal waar ze te gast zijn letterlijk vergiftigen. Het koraal verdrijft daarop de algen om zichzelf te beschermen. Maar zonder algen heeft het koraal geen voedsel en wordt het steeds zwakker.

Kwetsbaar
Het is mogelijk dat de riffen zichzelf herstellen, maar ze blijven daarna nog wel zeer kwetsbaar. Met name stormen, infecties en milieuproblemen komen in het vervolg twee keer zo hard aan. En dat heeft ook gevolgen voor andere oceaanbewoners. Koraalriffen verschaffen voedsel en een schuilplaats aan ongeveer 25 procent van alle zeedieren. Wanneer de algen verdwijnen, wordt deze kleurrijke woning als het ware onbewoonbaar verklaard: er is dan geen voedsel en geen bescherming meer.

Thailand
De riffen voor de kust van Thailand, Maleisië, Vietnam, Cambodja en Indonesië zijn zwaar getroffen. Ook nabij Sri Lanka en voor de oostelijke kust van Afrika is het raak. Volgens Thaise wetenschappers is 90 procent van hun koraal wit geworden en is reeds 20 procent dood. De kans bestaat dat het probleem in de toekomst alleen maar groter wordt. De watertemperaturen blijven namelijk stijgen.

Koraal is een bijzondere combinatie van dieren, algen en stenen en vormt enorme onderzeese constructies. Hierin leven duizenden vissen en leggen veel dieren hun jongen ter bescherming neer. Wanneer riffen door de verbleking worden aangetast kan het zeker tien tot zeventig jaar duren voor ze zich herstellen.

Links gezond koraal en rechts gebleekt koraal. Foto: NOAA

Bronmateriaal:
Coral reefs suffer mass bleaching” – Telegraph.co.uk

Coral bleaching Maldives Indian Ocean

Coral bleaching in Maldives, Indian Ocean Photo: ALAMY

WWF
Het WWF werkt aan adaptatie, aanpassing aan de klimaatverandering. De meest efficiënte manier om het Great Barrier Reef veerkracht te laten opbouwen tegen de klimaatverandering is om een netwerk van beschermde gebieden op te bouwen.

In 2004 verhoogde de Great Barrier Reef Marine Park Authority het aantal beschermde gebieden van 4,6 tot 33 procent, tot meer dan 11 miljoen hectare.

°
09/07/08

El Niño, la Niña en de Coral Sea

Koraalriffen houden van aangename temperaturen, niet te warm en niet te koud. Onregelmatig, maar gemiddeld eens in de drie tot zeven jaar, leidt El Niño tot zo’n uitgebreide en sterke verwarming van het oceaanwater dat de hele atmosfeer daar gedurende langere tijd door wordt beïnvloed. La Niña is fysisch gezien het tegengestelde effect. Die doet zich voor wanneer ongewoon koud zeewater bij de Evenaar is gemeten.

Op vele plekken ter wereld heeft de El Niño van 1998 grote schade aangericht aan koraalriffen.

Zo ook in het Great Barrier Reef.

Zo’n 3 procent van de riffen in het Great Barrier Reef werd toen totaal verwoest. In 2002, 2006 en 2007 heeft opnieuw een El Niño plaatsgevonden. De langetermijnvoorspellingen zijn somber, het IPCC (Intergovernmental Panel on Climate Change), wetenschappelijk orgaan van de VN, heeft voorspeld dat het Great Barrier Reef met een ‘gemiddelde tot hoge zekerheidsgraad’ verwoest wordt door klimaatverandering in de komende 20 tot 50 jaar bij ongewijzigde trends. (mvl)

°

In beeld: koraal

Hoe mooi kan koraal zijn? Macrofotograaf Daniel Stoupin fotografeerde verschillende koraalsoorten, zoals Acropora sp.(foto 1) en Pocilipora damicornis (foto 6). Stoupin maakte gebruik van een volspectrum verlichting in plaats van ‘gewoon’ wit licht, waardoor alle fluorescerende accenten zichtbaar zijn.

 

koraal1-954x758

 

°

koraal2-954x568

°

koraal3-954x652

°koraal4-954x635

°koraal5-954x635

 

°koraal6-954x617

 

°

Meer koraalfoto’s bekijken? Ga naar de website van Daniel Stoupin. Vergeet niet om de bijzondere video hieronder te bekijken.

°
09/07/08
Opwarming zeewater bedreigt walvissen in Coral Sea
Walvissen voelen zich zeer goed in de warme wateren van het Great Barrier Reef en de Coral Sea. Elk jaar tussen augustus en november komen daarom bultruggen van de Zuidelijke IJszee naar de kust voor de Whitsundays en voor Fraser Island om daar hun jongen ter wereld te brengen. Maar hoe lang nog?Want de gebieden rond de Zuidpool waar walvissen op zoek gaan naar voedsel, zullen steeds kleiner worden, steeds minder voedsel bevatten, en steeds verder weg liggen. Dat is het scenario dat walvissen in de oceanen rond Antarctica te wachten staat bij een globale opwarming van de Aarde van 2°C. De Coral Sea en het Great Barrier Reef worden bezocht door een dertigtal soorten walvissen.Blauwe vinvis
Het scenario staat te lezen in het rapport Ice breaker: Pushing the boundaries for whales. WWF publiceerde het rapport vlak voor het begin van een cruciale vergadering van de Internationale Walvisvaart Commissie in Santiago, Chili.Onder meer de blauwe vinvis, het grootste levende wezen ooit op Aarde, en de bultrug zullen veel moeilijker voedsel vinden. Die laatste soort is zich nota bene nog maar net aan het herstellen nadat ze bijna uitgeroeid was door de commerciële walvisvangst, vooral in de eerste helft van de 20e eeuw.Migratie
Beide walvissoorten migreren. Om te paren, te kalven en hun jongen te zogen, verblijven ze in meer noordelijke gebieden van de oceanen. Maar gedurende 3 à 4 maanden eten ze krill, hun primaire voedingsbron, in de oceanen rond Antarctica. Daar bouwen ze vetreserves op voor de rest van het jaar. De walvissen voeden zich ter hoogte van zogenaamde ‘frontale zones’, waar voedselrijk water uit de diepte omhoog komt, en waar grote populaties krill zwemmen.Door de opwarming van de Aarde verplaatsen deze frontale zones zich naar koudere gebieden rond de Zuidpool, en met hen, ook het belangrijke krill. Migrerende walvissen zullen daardoor mogelijk 200 tot 500 kilometer verder naar het zuiden moeten zwemmen om op zoek te gaan naar voedsel. Deze extra afstand in hun jaarlijkse migratie kost hen extra energie en verkort de periode waarin de walvissen vetreserves opbouwen.Minder krill
Omdat de zones die rijk zijn aan krill zich zuidwaarts zullen verplaatsen, komen ze ook dichter bij elkaar te zitten, waardoor het gebied waar de walvissen zich voeden, steeds kleiner wordt.Bovendien zal er steeds minder krill en dus minder voedsel beschikbaar zijn voor de walvissen. Dat komt omdat de levenscyclus van krill afhankelijk is van zee-ijs, en er in de oceanen rond Antarctica tot 30 procent minder zee-ijs zal zijn bij een globale opwarming van 2°C.Dramatische veranderingen
“Als we niet spoedig de klimaatopwarming afremmen, zal deze situatie bereikt worden in minder dan 40 jaar tijd. Een soort zoals de dwergvinvis, die sterk afhankelijk is van zee-ijs, zal op amper iets meer dan een generatie tijd te kampen krijgen met dramatische veranderingen in zijn leefgebied,” vertelt Dr. Susan Lieberman, Directeur van het Soortenprogramma van WWF International en hoofd van de WWF-delegatie op de vergadering van de IWC. “De gevolgen voor walvissen is een reden te meer voor de wereld om doortastende maatregelen te nemen om de klimaatverandering te stoppen.” (mvl)
°
09/07/08
Hoe de mens de Coral Sea bedreigt
1. Visserij
Naast klimaatverandering is destructieve visserij een ernstige bedreiging voor het Great Barrier Reef.
Vooral trawling richt veel schade aan.
Bij deze visserijvorm worden netten over de bodem gesleept die alles wat er leeft verwoesten. Een bijkomend groot probleem van de trawlingvisserij is de bijvangst van bijvoorbeeld haaien en zeeschildpadden.2. Afval
Vervuiling vanaf het land zorgt dat koralen verstikken.
Bodemdeeltjes vanaf land spoelen door erosie via rivieren direct uit in zee.
Ook chemische middelen die de landbouw gebruikt zijn funest voor het gebied.
Een teveel aan kunstmest bijvoorbeeld zorgt voor overmatige algengroei, waardoor ook verstikking voor koralen dreigt.3. Toerisme
Twee miljoen toeristen leveren de mensen die aan het Great Barrier Reef wonen jaarlijks meer dan 3 miljard euro op. Het rif staat wereldwijd bekend als het meest indrukwekkende snorkel- en duikgebied met helder water en een kijkdiepte tot 60 meter.
Maar, dit toerisme vormt tegelijkertijd ook een grote bedreiging voor het koraalrif. De duizenden snorkelers en duikers per jaar zijn niet bevorderlijk voor het koraal en haar inwoners. (mvl)
°
09/07/08
Als koralen seksen, zie je het vanop de maan

Met zijn 344.400 km2 is het Great Barrier Reef de enige natuurlijke levensvorm die vanuit de ruimte te herkennen is. Om die reden wordt het ook wel het achtste wereldwonder en het “grootste aquarium van de wereld” genoemd.Elk jaar in november is er een speciaal natuurspektakel in het noordelijke Great Barrier Reef: de sneeuwstorm. Enkele dagen na de eerste volle maan in de lente stoten alle koralen alsof ze op een geheim teken reageren tegelijk hun eieren en spermacellen af. Uit de hele wereld komen duikers om de kleurrijke sneeuwvlagen onder water te beleven.Het is zo spectaculair en immens dat je het zou kunnen zien mocht je er vanop de maan naar staan kijken. (mvl)

koraleneitjes
koraaleitjes
koraleneitjes
koraaleitjes

( van PIERRA )

http://ascendenza.wordpress.com/2010/02/25/biodiversiteit-in-de-oceaan-deel-3/

Filmpjes over dit fenomeen dat ‘spawning’ heet zijn te vinden op youtube 1, 2 (National Geographic).

°
Voor 4.000 euro medicamenten in hectare koraalrif
De rijkdom van de zeeën blijkt de jongste jaren steeds duidelijker in de geneeskunde. Sponzen en andere ongewervelden blijken een bijzonder vruchtbare bron te zijn van nieuwe antibiotica en van farmaceutisch werkzame stoffen voor de bestrijding van kanker en Alzheimer.De waarde van hotspots met een hoge biodiversiteit wordt voor de medische aspecten alleen al op ongeveer 4.000 euro per hectare geschat. (mvl)
°

2008: Jaar van het koraalrif

De toenemende uitstoot van CO2 in de atmosfeer heeft niet alleen gevolgen voor het klimaat, maar ook voor het leven in zee. Hoe meer CO2, hoe zuurder de oceanen worden. En in zuur water groeit geen koraal, omdat calciumcarbonaat, de bouwsteen van de koraalskeletjes, oplost in zuurder water. Deze week roepen zeventien internationaal vermaarde marien biologen op tot handelen. Als we niets doen, betogen ze, zijn de koraalriffen binnenkort verdwenen – en daarmee een uniek ecosysteem.

fotoverslag vr 14-12-2007 14:19

Nederlander ontdekt nieuwe koraalsoort op plafond van grotten

 12 oktober 2012 0
Bronmateriaal:
New Cave-Dwelling Reef Coral Discovered in the Indo-Pacific” – Pensoft Publishers (via Sciencedaily.com).
De foto bovenaan dit artikel is gemaakt door Bert W. Hoeksema (ZooKeys 228: 21–37, doi: 10.3897/zookeys.228.3798).

De Nederlandse onderzoeker Bert Hoeksema heeft in de Stille Oceaan een nieuwe soort koraal ontdekt. Het koraal leeft in grotten en hecht zich daar aan de plafonds.

De nieuwe koraalsoort heeft de naam Leptoseris troglodyta gekregen en onderscheidt zich op meerdere gebieden van koraal dat nauw aan L. troglodyta verwant is. Zo is de kom van het koraal veel kleiner.

Algen
Een ander opvallend verschil is dat het koraal niet samenwerkt met algen. Veel soorten koraal hebben algen nodig om te groeien en te overleven. Wanneer de temperatuur van het zeewater stijgt, gaan de algen overuren draaien en doen ze het koraal niet langer goed. Het koraal kan niet anders dan de algen afstoten. Het zorgt ervoor dat het koraal zijn voedselbron verliest en ook verbleekt.

Foto: Bert W. Hoeksema (ZooKeys 228: 21–37, doi: 10.3897/zookeys.228.3798).

Trager groeien
L. troglodyta heeft dat probleem niet: het koraal hoeft het namelijk niet van algen te hebben, zo schrijft Hoeksema in het blad Zookeys. Waarschijnlijk zorgt dat er wel voor dat dit koraal heel traag groeit. Maar mogelijk is dat ook niet erg: zo heel veel ruimte is er niet op de plafonds van de grotten.

Hoeksema gaat ervan uit dat L. troglodyta tot het geslacht Leptoseris behoort. In tegenstelling tot veel andere soorten koraal die het beste gedijen in oppervlaktewateren, doen enkele soorten uit dit geslacht het juist weer beter op grotere diepte. Soms leven ze wel zo’n veertig meter diep. Zo diep is L. troglodyta nog niet aangetroffen: Hoeksema vond het tot een diepte van zo’n 35 meter terug.

Nieuwe koraalsoort ontdekt nabij de Gambier-eilanden

 29 juli 2013 0

koraal

Wetenschappers hebben nabij een eilandengroep die deel uitmaakt van Frans-Polynesië een nieuw soort koraal ontdekt. Het koraal heeft grote uitstulpingen (poliepen) en is er in verschillende kleuren.

De onderzoekers hebben het koraal de naam Echinophyllia tarae gegeven. Het koraal groeit op zo’n vijf tot twintig meter diepte en doet het zowel goed op oppervlakken die veel licht opvangen, als op oppervlakken die in de schaduw liggen.

Het koraal heeft grote poliepen en is er in verschillende kleuren. Zo troffen de onderzoekers heldergroene, maar ook gelige en bruinige varianten aan (zie de afbeelding hieronder).

Het koraal bleek rondom de Gambier-eilanden veelvuldig voor te komen. Onduidelijk is nog of het koraal ook elders ter wereld leeft, zo stellen de onderzoekers in het blad Zookeys.

Echinophyllia tarae. Afbeeldingen: Benzoni F (2013) Echinophyllia tarae sp. n. (Cnidaria, Anthozoa, Scleractinia), a new reef coral species from the Gambier Islands, French Polynesia. ZooKeys 318: 59–79. doi: 10.3897/zookeys.318.5351.

Echinophyllia tarae. Afbeeldingen: Benzoni F (2013) Echinophyllia tarae sp. n. (Cnidaria, Anthozoa, Scleractinia), a new reef coral species from the Gambier Islands, French Polynesia. ZooKeys 318: 59–79. doi: 10.3897/zookeys.318.5351.

Bronmateriaal:
A new coral reef species from the Gambier Islands, French Polynesia” – Pensoft.net
De foto bovenaan dit artikel is gemaakt door xx (cc via Flickr.com).

International Year of the Reef 2008
_

What Are Coral Reefs?

Benefits of Coral Reefs

Status of and Threat to Coral Reefs

COLD (DEEP) WATER REEFS

Algen vergiftigen het koraal

18 oktober 2011 0

Wetenschappers hebben ontdekt dat sommige soorten algen koraal ernstig ziek kunnen maken en soms zelfs doden.

Normaal gesproken eten vissen een groot deel van de algen op. Maar door overbevissing zijn er steeds minder vissen en kunnen algen hun leefgebied vergroten. Dat doen ze onder meer rondom Fiji. Tientallen procenten van de oceaanbodem zijn hier met algen bedekt.

Aanraken
Welke gevolgen heeft dat voor het koraal hier? Wetenschappers zochten het uit. Ze namen het koraalAcropora millepora en brachten het letterlijk in aanraking met acht verschillende soorten algen. En dat had grote gevolgen. Binnen twee weken tijd begon het koraal te verkleuren en af te sterven, zo schrijven de onderzoekers in het blad Proceedings of the National Academy of Sciences.

Stofje
Hoe doen de algen dat? De onderzoekers analyseerden de algen en de stofjes die ze afgeven. Ze ontdekten dat het stofje terpenen de boosdoener was. De algen vergiftigen hiermee normaal gesproken vissen die aan ze knabbelen. Maar ook wanneer ze met koraal in aanraking komen, laten ze het los.

Hard
Lang niet alle algen zijn even hard. Sommige laten koraal direct afsterven. Anderen laten het alleen maar verkleuren. Het onderzoek wijst er in ieder geval op dat riffen die het – onder meer door veranderende temperaturen – toch al zo moeilijk hebben, op nog meer manieren dan gedacht dwars worden gezeten. En de mens heeft daar invloed op. Zo is er voor zover bekend maar één vis die de gevaarlijkste algen wel durft te eten: de konijnvis. Als mensen daar intensief op jagen, zullen de algen helemaal niet meer te houden zijn en lijkt het koraal gedoemd om te verdwijnen.

Of de algen ook in staat zijn om volwassen, zeer gezonde stukken koraal helemaal te laten verdwijnen, is twijfelachtig. Waarschijnlijk is het vooral heel jong en zwak koraal dat door toedoen van de algen het loodje legt.

Bronmateriaal:
Toxic Seaweed Poisons Coral Reefs on Contact” – Wired.com
De foto bovenaan dit artikel is gemaakt door Flightsaber (cc via Flickr.com).

WIST U DAT?…sommige koralen het Romeinse rijk nog hebben meegemaakt? Ze zijn zeker 2000 jaar oud!

Coral Reef Links

°
Als de CO2-uitstoot op eenzelfde manier verder blijft stijgen, worden de koraalriffen overal ter wereld met uitsterven bedreigd. Dat staat te lezen in een studie van het Carnegie Instituut in Washington. De resultaten van de studie verschijnen vrijdag in Science.

Verzuring oceaanwater
De hoge verzuring van het oceaanwater door de CO2-uitstoot lost de mineralen op, waardoor er ontkalking optreedt van de riffen en ze vernietigt, zo zeggen de onderzoekers van het instituut.Als de CO2-uitstoot niet gestabiliseerd of verminderd wordt, zullen 98 procent van de koraalriffen in 2050 in te zuur water baden.Eenderde CO2-uitstoot geabsorbeerd door oceanen
Op dit ogenblik stijgt de CO2-uitstoot snel door menselijk toedoen.
“Ongeveer een derde van de CO2-uitstoot wordt geabsorbeerd door de oceanen, wat het broeikaseffect tegenhoudt maar wel catastrofale gevolgen heeft voor het leven in de oceanen”, zo zegt een van de onderzoekers, Ken Caldeira.Volgens Bob Steneck van de universiteit van Maine zijn in Azi_e een miljard mensen afhankelijk van de koraalriffen voor hun inkomsten.
(belga/lb)
°
Kleine waterdiertjes hebben het Grote Barrière Rifgevormd. Het is zo enorm, dat het vanaf de maan te herkennen is. Het herbergt een rijkdom aan levensvormen, even kleurrijk en veelsoortig als in het tropische regenwoud.Ondanks zijn naam is het Grote Barrière Rif niet één enkel rif. Een heel vlechtwerk van riffen strekt zich uit over een afstand van 2000 kilometer parallel aan de noordoostkust, van de Lady Elliott Eilanden bij de kust van Zuid-Queensland tot aan de Golf van Papoea Nieuw-Guinea.Oorsprong en kenmerken
Ongeveer 18 miljoen jaar geleden begon het grote barrièrerif zich te ontwikkelen. In de huidige ontwikkelingsfase, die reeds 2000 jaar duurt, worden nieuwe lagen op de oudere fundamenten afgezet. Het rif ligt op verschillende afstanden, tussen 15 en 200 kilometer, van de kust verwijderd en strekt zich uit over een oppervlak van 230.000 vierkante kilometer. Het grootste gedeelte omvat meer dan 2100 riffen, en er zijn ongeveer 540 dicht onder de kust gelegen eilandjes door ringriffen omgeven. In het noorden en zuiden liggen de riffen dicht opeen, dit in tegenstelling tot het midden gedeelte. In het noordelijk gedeelte, daar waar mangrovebomen kunnen groeien, zijn er bovendien veel mangrovemoerassen. Tussen het grote barrièrerif en de kust strekt zich de lagune uit. Het is een ondiepe watervlakte, die meestal niet dieper gaat dan 100 meter. De bodem ligt in de luwte van het rif en is met een sliklaag bedekt. Aan de zeezijde gaat het rif duizenden meters stijl de diepte in en staat volkomen bloot aan het volle geweld van de golven en stormen. Hier groeit het koraal het sterkst, maar tevens gaat het meeste materiaal verloren op de plaatsen waar storm en golven hun tol eisen. Een groot deel van het losgerukte materiaal wordt echter weer teruggeworpen en vormt weer ‘nieuwe rotspartijen’. Zo is het rif in een voortdurend proces van afbraak en wederopbouw verwikkeld.
Het ontstaan van het koraalrif
Koraalriffen zijn eigenlijk ‘levende rotspartijen’. Zij bestaan uit duizenden anemoonachtige levende wezens, poliepen. Zij bedden zich in kalkskeletten in die door hun voetschijven worden aangemaakt. Ieder jaar dijt het rif naar buiten en boven toe uit. Wanneer de poliepen zich voortplanten en er nieuwe poliepen aangroeien. Iedere poliep is met strengen levend materiaal verbonden met zijn buren en draagt zodoende bij aan de algehele versteviging.
Kalkroodwieren, die er als roze verfdruppels uitzien, zijn ook zeer belangrijke rifbouwers. Zij produceren kalksteen dat het rif nog steviger maakt. Roodwieren die vooral aan de rifkanten leven, maken een soort mortel die sedimentvlakken aan elkaar vast kit. In vele, vele jaren bouwt de totale levensgemeenschap zo een enorme gestructureerde massa op het koraalrif, waarvan slechts een klein gedeelte bestaat uit levende wezens en het grootste deel uit kalksteenskeletten. Iedere koraalsoort heeft zijn eigen groeiwijze. Daardoor ontstaat er een grote verscheidenheid aan vormen – heuvels, plateaus, tafelvormen, waaiers, takken en geweistructuren.Het dierenleven bij het rif
Een groot deel van de koralen is wit – de skeletsubstantie van dode poliepen. Levende poliepen zijn daarentegen dikwijls opvallend bont van kleur. Verwanten van de koralen, de waaierkoralen en zeeveren, alsook sponzen en andere levende wezens, bezitten heldere kleuren. Blauwe en gele rifbaarzen en felschitterend roze, lilagekleurde en gele lipvissen wedijveren met levendig witrood gekleurde zeeslakken, smaragdgroene slangsterren en helblauwe zeesterren. Deze schitterende kleuren zijn bedoeld om rovers in verwarring te brengen, maar tegelijk duidelijk aan te geven tot welke soort elk dier behoort.
Teamwork bij vissen
Op het rif komen vissen zo nu en dan samen om de komst af te wachten van bepaalde garnalen en lipvissen. Deze bevrijden de grotere vissen van parasieten en aangetast weefsel. Beide profiteren hiervan – de ‘schoonmakers’ hebben een zekere voedingsbron, en hun ‘cliënten’ blijven gezond.Een ander voorbeeld van symbiose is het samenspel van holbewonende zeegrondels en pistoolkreeften. Een kreeftenpaartje graaft en onderhoudt een tunnel en leeft hier samen met een zeegrondel-paar. De grondels met hun scherpe ogen, geven elk teken van gevaar door aan de slechtziende kreeften, door met hun staart tegen de voelsprieten van de kreeften aan te slaan.De vissen van het Grote Barrière Rif
Er leeft een ongelooflijke veelheid aan dieren rond het rif; van kleine, drijvende kwallen tot reuzenhaaien. Zeeschildpadden leven hier in grotere aantallen dan waar ook ter wereld. Goedmoedige zeekoeien, zwemmende verwanten van de olifant, bewegen zich traag door het zeegras en er waden vogels, zoals de rifreiger, door de ondiepe gedeeltes om vis te vangen.
Behalve 400 koraalsoorten leven bij het rif 200 soorten porseleinslakken en waarschijnlijk meer dan 2000 vissoorten (ongeveer een tiende van alle bekende soorten). Zon 200 soorten kunnen zich tegelijkertijd op een oppervlak van niet meer dan een voetbalveld bevinden.Een heel leger van dieren graaft en boort zich in het rif naar binnen zoals onder andere boorzwammen, wormen, schelpdieren, zeeegels en koraaletende zeeslakken.Bovendien eten verschillende vissen levende koralen: papegaaivissen knippen als het ware met hun scherpe, snavelvormige voortanden kleine stukjes af. Met hun afgeronde kiezen malen ze de knarsende hap fijn om bij het poliepenvlees te komen.Ook zeesterren kunnen grote hoeveelheden koraal opeten. Zij stulpen hun maag uit en overgieten de poliepen met verteringssappen. Daarna halen zij hun maag weer binnen zoals een visser zijn net. Hun vangst is een gedeeltelijk verteerde koraalsoep. De beruchte doornenkroon-zeester kan in zijn eentje per dag een vierkante meter koraal verorberen.
_

Groei Great Barrier Reef naar dieptepunt

202 01 2009

© ANP

CANBERRA – Het Great Barrier Reef, een groot koraalrif voor de kust van Australië, heeft zwaar te lijden onder klimaatverandering. Door opwarming van het zeewater is de aangroei van nieuw koraal op het rif gedaald naar het laagste punt in 400 jaar

Dat schrijven Australische wetenschappers in een vrijdag gepubliceerd onderzoek in het wetenschappelijke tijdschrift Science.

Als de daling zich voortzet kan de nieuwe aangroei van het rif rond 2050 volledig stil komen te liggen, aldus de onderzoekers. Dan zou het koraalrif afsterven en door algen worden overwoekerd

Het Great Barrier Reef is een duizenden kilometers lang koraalrif voor de oostkust van Australië. Het gebied, dat op de Werelderfgoedlijst van VN-organisatie Unesco staat, herbergt duizenden dier- en plantensoorten. Ze gebruiken het koraal als voedsel en als schuilplaats tegen roofdieren.

ZIE OOK:

  • 11/03/2007 Afkoeling voor Great Barrier Reef

    Het Australische Groot Barrièrerif heeft de nodige afkoeling gekregen door overvloedige stortregens. Het grootste koraalrif ter wereld heeft zwaar te lijden onder de klimaatopwarming.Door het broeikaseffect steeg de temperatuur van het water, waardoor veel koraal dreigde af te sterven. Door aanhoudende regenval(begin 2007) daalde de temperatuur van de oceaan aanzienlijk. De watertemperatuur was in geen vijf jaar zo laag, meldde de Britse omroep zondag.

    Het Great Barrier Reef ligt voor de noordoostkust van Australië. Het is het grootste levende organisme ter wereld en staat sinds 1981 op de lijst van werelderfgoed van de Verenigde Naties.

  • 30/01/2007 Great Barrier Reef dreigt te verdwijnen

    Het Australische Great Barrier Reef, het grootste koraalrif ter wereld, dreigt binnen enkele decennia volledig te verdwijnen als gevolg van de opwarming van de aarde .Dat staat in een uitgelekt conceptrapport van de Verenigde Naties over de gevolgen van het versterkte broeikaseffect. Het rapport, waaraan deskundigen in Parijs deze week nog sleutelen, zal vrijdag openbaar worden.

    Verbleken

    De Australische media overschreeuwden elkaar dinsdag met de onheilstijdingen over een van de grootste toeristenattracties van Australië. Als de klimaatveranderingen doorzetten, dan zal het koraal vanaf 2030 op grote schaal verbleken en uiteindelijk sterven door warmer zeewater, dat tevens een hogere zuurgraad zal hebben.

    Koraal kan zich herstellen, maar deskundigen verwachten dat de veerkracht van het organisme door de aanhoudende klimaatveranderingen uiteindelijk onvoldoende zal zijn.

    Kyoto-protocol

    Australië heeft net als de Verenigde Staten het zogeheten Kyoto-protocol niet getekend. Dit internationale klimaatverdrag legt industrielanden doelstellingen op om de uitstoot van broeikasgassen te verminderen.

    Australië is ’s wereld grootste exporteur van kolen, een klimaatbedreigende fossiele brandstof.

°

Great Barrier Reef misschien slijmerige algenpoel

25 augustus 2009

Het Great Barrier Reef voor de kust van Australië kan een ‘slijmerige algenpoel’ worden, als er niets wordt gedaan tegen de wereldwijde opwarming van de aarde

De koralen die samen het unieke natuurgebied vormen, gaan dan dood en alleen de algen die in de kalkafzettingen leven, blijven over.

Die waarschuwing komt van bioloog Jos Mieog, die volgende week promoveert aan de Rijksuniversiteit Groningen op eenonderzoeknaar koralen.

Mieog heeft tegelijkertijd goed nieuws: uit zijn onderzoek is gebleken dat een aantal koraalsoorten een opwarming van één tot anderhalve graad kan overleven.

”De biodiversiteit van een van de indrukwekkendste natuurgebieden ter wereld neemt hoe dan ook af, maar we kunnen de schade beperken”, aldus de Groningse promovendus.

Larfjes

Koraal groeit uit larfjes, die zich op de bodem van de oceaan vestigen. In het kalkskelet dat deze larfjes bouwen, wonen eencellige algen. De koraal groeit van de suiker die de algen produceren, terwijl de algen overleven door de kalkbehuizing van het koraal.

Zo’n samenlevingsvorm heet in de natuur symbiose. Opwarming van het zeewater verstoort de symbiose, waardoor het koraal verhongert en sterft. De koraalriffen verdwijnen en alleen de algenlaag blijft over.

Warmtebestendige alg

Mieog ontdekte dat een aantal koralen op het Great Barrier Reef een warmtebestendige alg huisvest. Sommige soorten passen zich daardoor razendsnel aan opwarming aan.

”Als het de wereld lukt om de CO2-uitstoot drastisch te verminderen en de klimaatverandering te beperken tot anderhalf, hooguit twee graden, kan een aantal koralen overleven. Sommige wetenschappers denken dat alle riffen in een slijmerige massa zullen veranderen, maar mijn onderzoek is hoopgevend.”

Mieog woont inmiddels in Australië om verder onderzoek te kunnen doen naar de koraalriffen.

Bekijk een documentaire over de Great Barrier Reef

°

Australië wil in de Koraalzee ten noordoosten van de eigen kust

het grootste maritieme natuurreservaat ter wereld in het leven roepen

25 november 2011

In het gebied, anderhalf keer zo groot als Frankrijk, worden olie- en gasboringen verboden. De visserij zal er aan zeer strenge regels gebonden zijn. De maatregelen moeten de toekomst van het zee gebied met zijn kwetsbare koraalriffen en rijke en unieke biodiversiteit veilig stellen, aldus milieuminister Tony Burke. Australië.

De Koraalzee strekt zich uit van het Great Barrier Reef voor de Australische noordoostkust tot de Salomonseilanden, Vanuatu en Nieuw-Caledonië. Er leven zeldzame zeevogels en schildpadden en grote roofvissen die elders met uitsterven worden bedreigd.

De maatregelen moeten de toekomst van het zeegebied met zijn kwetsbare koraalriffen en rijke en unieke biodiversiteit veilig stellen, Er is ook het grote economische belang van het zeeleven voor Australië.

°

Australië geeft verwaarlozing koraalrif toe

 De Australische overheid heeft toegegeven dat het Great Barrier Reef de afgelopen tientallen jaren is verwaarloosd

3 oktober 2012

De regering trok het boetekleed aan nadat dinsdag naar buiten kwam dat ’s werelds grootste koraal de afgelopen 27 jaar is gehalveerd.

”We hebben de afgelopen jaren allemaal gehoord over schade aan het koraalrif”, zei milieuminister Tony Burke. ”Maar dat percentage van 50 procent heeft alarmbellen luid en duidelijk doen afgaan.” Hij erkende dat het koraalrif er beter aan toe zou zijn, als de zaken ”anders waren aangepakt”.

Het koraal verdween door zware stormen, zeesterren en verbleking van het koraal door verzuring en opwarming van het zeewater. Volgens Burke pakt de huidige regering alsnog verschillende problemen aan. Zo maken duikers nu jacht op de zeesterren, die zich voeden met de poliepen op het koraal.

Door: ANP

Het beroemde grote koraalrif in Australië brokkelt snel af, vooral de zuidelijke helft. De oorzaken zijn verdeeld over natuurlijke en menselijke factoren.

Lokale onderzoekers schrijven dat, na een onderzoek van 40 miljoen euro, maandag in PNAS. Het grote monitoringsprogramma is ongeëvenaard: de onderzoekers zaten, sinds het begin in 1985 zo’n 2700 dagen op zee en bestudeerden tientallen riffen.

De oorzaken van het afkalven zijn gevarieerd: 48 procent van de vernieling is het gevolg van stormen, 42 procent is opgegeten door de doornenkroonzeester en 10 procent is ‘gebleekt’.

Stormen zijn vooral de laatste tien jaar erg destructief geweest, en ook een factor waar de mens weinig aan kan doen. De opkomst van doornenkroonzeesterren kan voor een deel te wijten zijn aan overbevissing, omdat er minder van de zeestereitjes worden opgegeten.

Het koraal laat wel herstel zien, maar volgens de Australiërs gaat dat te langzaam. Als de trend van stormen en andere invloeden zich voortzet is het Great Barrier reef in 2022 nog eens gehalveerd.

0

Great Barrier Reef in slechte staat

10 juli 2013

Het gaat niet goed met het Australische Great Barrier-koraalrif. De gezondheid van het wereldberoemde natuurmonument is teruggelopen van matig naar slecht.

Getty Images

Great Barrier Reef in slechte staat Fotoserie

Dat blijkt uit een rapport van de Australische overheid, waarover media in het land woensdag schrijven.

Het Great Barrier Reef heeft de afgelopen jaren onder meer te lijden gehad onder natuurrampen als stormen en overstromingen. Zo beschadigde de cycloon Yasi in 2011 grote delen van het grootste rif ter wereld.

Het herstel zal waarschijnlijk tientallen jaren duren. Ook slagen pogingen om pesticiden en stikstof in het water terug te dringen maar ten dele en is het zeegras in zeer slechte conditie.

Het Great Barrier Reef voor de noordoostkust van Australië is zo’n 2600 kilometer lang. Het bestaat uit enkele duizenden verschillende riffen in allerlei vormen en groottes en meer dan 900 eilanden. Er komen ongeveer 1500 vissoorten voor en 400 soorten koraal. Sinds de jaren 80 is het natuurwonder al met de helft in omvang afgenomen.

Unesco

In juni werd bekend dat de beslissing of het koraalrif op de Unesco lijst van bedreigd werelderfgoedlijst komt, met een jaar werd uitgesteld. Australië zou zelf tekortschieten in het beheer van het rif.

Als het Great Barrier Reef op de lijst van bedreigd werelderfgoed wordt geplaatst, kan Australië op financiële steun rekenen uit een daarvoor speciaal opgericht fonds van Unesco.

Door: ANP/NU.nl

°

wo 10/07/2013   Judit Verstraete

http://www.deredactie.be/cm/vrtnieuws/buitenland/130710_greatbarrierreef

Het Great Barrier Reef in Australië verkeert in slechte staat.

Dat blijkt uit een reeks van rapporten die vrijgegeven zijn door de Australische overheid. Unesco dreigt ermee om het koraalrif volgend jaar op de lijst van bedreigd werelderfgoed te zetten

Het Great Barrier Reef is het grootste koraalrif ter wereld. Het ligt in de Koraalzee bij de kust van Queensland in Noordoost-Australië. Uit onderzoek blijkt dat de afgelopen 27 jaar het koraal dat het rif bedekt, gehalveerd is. Dat zou te wijten zijn aan extreme weersomstandigheden, zoals de tropische cycloon Yasi (foto) en de zware regenval.

Tussen 2010 en 2011 is de waterkwaliteit in het gebied gezakt van “gemiddeld” naar “zwak”. Het grootste deel van de landbouwers die in de regio werken, heeft zijn doelstellingen om de waterkwaliteit te verbeteren, niet kunnen waarmaken.

Die doelstellingen houden in dat ze pesticiden en lozingen van sedimenten, zoals grind, zand en klei moeten beperken.

AP

De Australische overheid maakte bekend dat ze de komende vijf jaar ongeveer 300 miljoen euro gaat vrijmaken om het Great Barrier Reef te beschermen. Met dat geld zullen nieuwe initiatieven opgestart worden om te voorkomen dat de landbouwactiviteiten in de buurt een vernietigende impact hebben op het koraalrif. De minister van Milieu van Queensland, Andrew Powell, had lof voor de landbouwers die wel al inspanningen doen om hun werking te verbeteren.

Greenpeace uitte kritiek op het plan van de de overheid. Dat zou te weinig doen om de export van kolen en de mijnen in de regio aan banden te leggen.

°

Unesco dreigt ermee om het koraalrif volgend jaar op de lijst van bedreigd werelderfgoed te zetten. Als dat gebeurt, kan Unesco voorkomen dat de havens van Queensland zich verder ontwikkelen.

_

“Caraïbische koraalriffen zijn binnenkort verdwenen”

wo 02/07/2014 – 
Joppe Matyn
De omvang van de koraalriffen in het Caraïbische Zeegebied is sinds de jaren 70 met de helft verminderd. Dat blijkt uit onderzoek van de Internationale Organisatie voor Natuurbescherming (IUCN). De organisatie trekt nu aan de alarmbel want “tegen dit tempo zijn de koraalriffen binnen 20 jaar volledig verdwenen”.

Onderzoekers van de IUCN zouden bij hun onderzoek zo’n 35.000 gegevens geanalyseerd hebben. Die data werden verzameld in 90 verschillende koraalriffen in het Caraïbische Zeegebied tussen 1970 en 2012. “De onderzoeksresultaten zijn onthutsend”, klinkt het.

Volgens de organisatie is 50 procent van de totale omvang van de riffen immers verdwenen. “Het koraal sterft als het ware af. Het transformeert van kleurrijke gebieden vol leven tot barre habitats die bedekt zijn met slijmerige algen”, stellen de wetenschappers.

Het rapport van het IUCN stelt dat de huidige situatie te wijten is aan overbevissing en ziektes. “In de jaren 80 zou een groot deel van de zee-egels bijvoorbeeld uitgeroeid zijn door een ziekte”, klinkt het. “En die zee-egels zijn een belangrijk symbiotisch wapen tegen de algen. Bovendien wordt op heel wat vissen gevist die eveneens broodnodig zijn om de wildgroei van algen in te perken.”

Toch is de organisatie niet helemaal defaitistisch. “We zien dat als we tijdig ingrijpen, het koraal weer herleeft. Maar dan moet het wel beschermd worden.”

°

Koraal kan sneller schakelen dan gedacht

10 oktober 2011 5

Koraal kan veel sneller schakelen dan gedacht en maakt mogelijk toch een kans als de aarde verder opwarmt

Klimaatverandering is op dit moment één van de grootste vijanden van het koraal. Het water wordt warmer en dat vraagt om nieuwe overlevingstactieken. Veel onderzoekers zien het somber in en stellen dat koraal zich niet op tijd aan de veranderende omstandigheden kan aanpassen, maar wetenschapper Mauricio Rodriguez-Lanetty laat zien dat we het koraal niet mogen onderschatten.

VERBLEKING

Verbleking van koraal ontstaat door warmte. Algen gedijen heel goed bij warmere temperaturen. Sterker nog: ze worden er overactief van. Het koraal verwijdert de hyperactieve algen om zichzelf te beschermen, maar raakt zo ook een bron van voedsel kwijt en verzwakt. En verzwakt koraal ziet een beetje pips en kan uiteindelijk zelfs afsterven.

Experiment
Hij verzamelde wat van het koraal Acropora millepora. Dit koraal doet het goed bij een temperatuur van 21 of 22 graden Celsius. De onderzoeker liet het acht dagen op een temperatuur van 31 graden leven. Het resultaat: het koraal verbleekte sterk.

Hoop?
Slecht nieuws zou u zeggen. Maar een tweede experiment laat zien dat er hoop is. De onderzoeker herhaalde het experiment, maar liet het koraal niet direct in water van 31 graden Celsius zakken. In plaats daarvan mocht het koraal eerst tien dagen wennen aan 28 graden Celsius. En daarna ging het pas naar het nog warmere water. En dat hielp: het koraal overleefde en verbleekte niet. Wat het koraal precies deed om te overleven, is onduidelijk. Maar wat het ook was: het koraal kan snel schakelen, zo is in het blad Proceedings of the Royal Society B te lezen.

Maar is dat genoeg om het grillige karakter van een veranderend klimaat te weerstaan. Rodriguez-Lanetty is voorzichtig. Het is onduidelijk of het koraal permanent bestand is tegen de hitte of dat het slechts een tijdelijk effect is. En zolang dat onduidelijk is, ziet het er nog steeds niet zo goed uit voor het kleurrijke organisme.

°

Bronmateriaal:
Corals might learn to adapt to warmer seas” – Newscientist.com
De foto bovenaan dit artikel is gemaakt door J. Hutsch (via Wikimedia Commons).

°

Bedreigde dieren in de Coral Sea:

de Napoleonvis

In de Coral Sea leven 47 dieren die alarmerend dicht bij uitsterven staan.
Wetenschappelijke naam: Cheilinus undulatus
Engelse naam: humphead wrasse
Verspreiding:
naast de Coral Sea ook de Rode Zee, Indisch en Stille Oceaan, Tuamotu-eilanden,
Ryukyu-eilanden, Nieuw-Caledonië, Arabische Zee ondiepe kustwateren in de zuidwestelijke Stille Oceaan en de Indische Oceaan.
Langs rifhellingen en dropoffs, en soms ook op laguneriffen. Tot 60 meter diepte.
Voedsel: weekdieren
Lengte: 230 cm
Gewicht:190 kgDe napoleonvis wordt als delicatesse gezien in Azië.
Deze koraalvis, die 2 meter lang kan worden en dan zo’n 190 kilo weegt, wordt steeds vaker geserveerd in restaurants.Cyanide
Omdat de vis veel oplevert , zijn de vangstmethoden ruwer geworden: vaak wordt cyanide in het water gegooid, zodat de napoleonvis bewusteloos raakt en uit het water kan worden gehaald.
Kleine vissen en het koraal lijden hier ook onder.
Internationale handel in de koraalvis blijft alleen toegestaan met een vergunning.
Bij de verlening daarvan wordt gekeken of de handel geen schade toebrengt.Gehalveerd
Desondanks is de populatie van napoleonvissen in de Coral Sea de jongste dertig jaar meer dan gehalveerd.
Snel herstel zit er niet in omdat de napoleonvis pas na zes jaar geslachtsrijp is.Nieuwsgierig
Napoleonvissen zijn van nature zeer nieuwsierig, zij naderen duikers tot op enkele meters en inspecteren hen dan met hun indrukwekkende ogen.
De napoleonvis is dan ook bij elke duiker een graag geziene en bijzonder geliefde vis.De napoleonvis is de grootste en zwaarste onder de lipvissen.
Ze zijn herkenbaar aan de enorme grootte en de bult op het voorhoofd.
Een Napoleonvis kan 30 jaar oud worden. (mvl)
_
15/07/08

DOEJONG

de doejong of Indische zeekoe.

Wetenschappelijke naam: Dugong dugon
Engelse naam: dugong
Verspreiding: ondiepe kustwateren in de zuidwestelijke Stille Oceaan en de Indische Oceaan
Voedsel: zeegras
Lengte: 3 – 4 m, bij geboorte 1 m
Gewicht: 400 – 600 kg, bij geboorte 20 – 35 kg

De doejong is een vrij slanke zeekoe, die in kustwateren leeft. Doejongs grazen op bedden met zeegras. Daarbij trekken ze vaak de hele plant met wortels en al uit de bodem en maken ze herkenbare kale stroken in de zeegrasbedden.

Doejongs hebben een sikkelvormige staart (dus duidelijk anders dan de ronde staart van de lamantijnen) en kunnen verrassend snel zwemmen: tot 20 km per uur. Dit houden ze echter niet lang vol.

Uitgestrekte reservaten
Doejongs zijn al heel lang bejaagd door de oorspronkelijke bewoners van Australië, de Perzische Golf en Micronesië. In een aantal gebieden wordt de jacht nu gereguleerd en zijn veelal met steun van het Wereld Natuur Fonds reservaten ingesteld (Kenia, Papoea Nieuw-Guinea, Australië). Omdat de doejong grote zeegrasvelden nodig heeft, is het belangrijk dat de reservaten behoorlijk uitgestrekt zijn. Jammer genoeg is de doejong ondertussen al wel verdwenen in de wateren van Bangladesh, Myanmar, Mauritius en Taiwan. Maar het dier valt te redden: aan de west- en noordkust van Australië neemt de bevolking niet langer af en is al twee jaar behoorlijk stabiel.

Zeemeermin
De doejong is de meest aan het leven in de zee aangepaste van alle zeekoeien. Het is het enige nog levende lid uit de eens grote familie der doejongs (Dugongidae). Een ander lid van de familie, de Stellerzeekoe, stierf uit in de achttiende eeuw. De naam “doejong” komt van het Maleise “duyung”, wat zeemeermin betekent. Waarschijnlijk zijn de legenden over zeemeerminnen ontstaan door ontmoetingen tussen zeelieden en doejongs.

Onder water
De doejong is een herbivoor. Hij eet de bladeren en wortelen van waterplanten. Soms eet hij ook ongewervelde dieren. Het is een dagdier, dat in verstoorde gebieden vaker ’s nachts actief is. Om te eten duikt hij tot een diepte van twaalf meter. Hij blijft meestal ongeveer een minuut onder water, maar hij kan acht minuten onder water blijven. Ze leven in groepen in een vast woongebied van vier tot elf km².

Het jong wordt geboren op een ondiepe plaats langs de kust. De moeder laat het jong zogen door haar tegen haar borst aan te drukken. Na achttien maanden wordt het jong gespeend. Het jong blijft bij de moeder tot de geboorte van het volgende jong.

Straf van goden
Veel volkeren, onder andere op Madagaskar, de Comoren en Nieuw-Guinea, kennen verhalen van mensen die in doejongs zijn veranderd, als straf van de goden of juist als redding van de verdrinkingsnood. Ook wordt vermoed dat ontmoetingen tussen deze dieren en zeemannen aan de basis liggen van verhalen over sirenes en zeemeerminnen. De sirenes uit de Odyssee van Homerus waren waarschijnlijk doejongs uit de Rode Zee. (bron: wwf, wikipedia)

°
09/07/08
Bedreigde dieren in de Coral Sea: de gevlekte adelaarsrog

Wereldwijd staat deze vis op de lijst met ‘bijna bedreigde diersoorten’.

Wetenschappelijke naam: Aetobatus narinari
Engelse naam: spotted eagle ray
Verspreiding: naast de Australische wateren ook in de buurt van North Carolina en Florida, in de Golf van Mexico, in de Caraïben, ten zuiden van Brazilië en langs de kusten van Zuid-Afrika tot Hawai (ook nabij Japan).
Voedsel: schaaldieren, garnalen en andere vis
Lengte: tot 250 cm (zonder staart) – tot 500 cm (met staart)
Gewicht: 230 kg

De gevlekte adelaarsrog is met een vlekkenpatroon op de rug de mooiste van alle roggen die in de oceaan zwemmen. Met hun lange puntige staart zijn ze vergelijkbaar met de bekendere pijlstaartroggen. De vissen komen wereldwijd voor in water met een tropisch warme temperatuur. Ze leven vaak in baaien en in koraalriffen op ongeveer zestig meter diepte. De roggen leven in grote scholen en komen soms dichtbij het wateroppervlak.

Giftig
Als ze zwemmen, maken ze een gracieuze vliegende beweging. Er wordt niet doelbewust op gevist, omdat het vlees van de vis geen goede kwaliteit heeft. Voor sportvissers zijn de roggen wel aantrekkelijk omdat ze een felle strijd leveren. Ze blijven meestal uit de buurt van duikers, maar in contact zijn ze wel gevaarlijk. Hun lange staart is giftig en kan ernstige wonden veroorzaken.

Haaien
Tijdens de paring worden vrouwelijke adelaarsroggen gevolgd door meerdere mannetjes. Ze bijten zich vast en één mannetje zal het vrouwtje op haar rug gooien. Het paren zelf duurt dertig tot negentig seconden. De eitjes worden in het lichaam van de moeder uitgebroed. Haaien vormen een belangrijk gevaar voor de gevlekte adelaarsrog. Een haai achtervolgt de roggen soms tijdens het geboorteseizoen. Ze verorberen dan vaak de jongen van de rog. (gb)

°
05/08/08
Bedreigde dieren in Coral Sea:
de bultkoppapegaaivis
Wetenschappelijke naam: Bolbometopon muricatum
Engelse naam: bumphead parrotfish
Verspreiding: in riffen in de Rode Zee, de Atlantisch, Indische en Stille Oceaan en in de Great Barrier Reef in Australië.
Voedsel: koralen, algen
Lengte: tot één meter lang
Gewicht:tot 50 kiloDe bultkoppapagaaivis dankt zijn naam onder meer aan de manier waarop de tanden in zijn bek staan. Daardoor lijkt zijn mond een beetje op de bek van een papagaai. In tegenstelling tot andere papagaaivissen heeft deze soort een verticale kop. De vissen kunnen liefst één meter lang worden en vijftig kilo wegen. Ze groeien traag, maar kunnen vaak ouder dan veertig jaar worden.De kleur van bultkoppapagaaivissen is grijsachtig tot donkergroen. Jonge vissen zwemmen vaak in ondiepe lagunes van het koraalrif. Bij het verzamelen van voedsel bijten ze soms stukken uit het koraal. Hun stompe hoofd kan daarbij als stormram dienen. Duikers kunnen de vissen maar moeilijk benaderen, want ze zijn heel voorzichtig.
De bultkoppapagaaivis is een bedreigde soort en staat momenteel genoteerd als ‘kwetsbaar’. Ze slapen meestal in grote groepen en zijn daardoor een gemakkelijk slachtoffer voor speervissers. (gb)
22/08/08
Advertenties

BRYOZOA

Mosdiertjes groeien de pan uit

Caroline Hoek|23 februari 2011

Wetenschappers hebben ontdekt dat Bryozoa (ook wel mosdiertjes genoemd) de afgelopen twee decennia razendsnel groeien. De reden is onduidelijk. Zo op het eerste gezicht lijkt de groei van de mosdiertjes van de soort Cellarinella nutti heel positief: ze zorgen ervoor dat meer CO2 in de oceanen opgesloten komt te zitten. Hoe meer en hoe groter de mosdiertjes, hoe beter.

De wetenschappers keken naar de mosdiertjes die nu in de wateren rondom Antarctica voorkomen, maar doken ook in de geschiedenis. Robert Falcon Scott ontdekte de mosdiertjes aan het begin van de vorige eeuw en legde een collectie met wetenschappelijke ontdekkingen aan. Daarin bevinden zich ook mosdiertjes van een eeuw oud. Door die te vergelijken met de moderne tegenhanger konden de wetenschappers achterhalen hoe de soort zich ontwikkeld heeft. “Nu mensen heel geïnteresseerd zijn in veranderingen op de polen zijn deze exemplaren van ongelooflijke waarde geworden,” vertelt onderzoeker David Barnes. “Het is de enige bron van informatie uit de tijd.”

Calciumcarbonaat
Net als bomen hebben de mosdiertjes jaarringen. Hieraan is goed te zien hoe hard de dieren ooit groeiden. Dankzij de collectie van Scott kon Barnes’ team de groei van de mosdiertjes in de periode tussen 1890 en 2008 bestuderen. De mosdiertjes gebruiken calciumcarbonaat om hun harde, uitwendige skelet te vormen. Uit het onderzoek blijkt dat de hoeveelheid calciumcarbonaat die de dieren verkregen tussen 1890 en 1970 vrijwel hetzelfde bleef. Maar tussen 1990 en 2008 gingen de organismen gemiddeld twee keer zoveel calciumcarbonaat opnemen en groeiden ze ook twee keer zo hard.

Algen
De reden daarvan is onduidelijk. Waarschijnlijk heeft het te maken met de algen die de mosdiertjes eten. Deze algen zijn om wat voor reden dan ook de laatste tijd langer beschikbaar en dus kunnen de mosdiertjes er meer van nuttigen. Waarom de algen langer beschikbaar zijn, is eveneens een raadsel. “Dit deel van Antarctica wordt niet warmer en het gebied lijkt geen ijs te verliezen.”

Opslag van CO2
Klimaatverandering lijkt dus niet de reden te zijn, maar de ontwikkeling heeft wel gevolgen voor de verandering van temperaturen. Mosdiertjes bedekken de zeebodem en worden door stromingen meegevoerd en afgebroken. Vervolgens belanden de organismen (en al het voedsel dat ze bevatten, onder meer koolstof) op de bodem van de zee. Daarmee wordt het CO2 voor altijd uit het water en de voedselketen gehaald en op de bodem opgeslagen.

Of de mosdiertjes echt een verschil maken, is onduidelijk, maar alle beetjes helpen. Het complete onderzoek is terug te vinden in het blad Current Biology.

De rechten op bovenstaande foto behoren toe aan de British Antarctic Survey.

Klik hier voor meer info!Bryozoa

Mosdiertjes zijn kolonie-vormende zeedieren. De kolonies lijken op kleurloos zeewier, een stuk kraakbeen, vitrage of kolonies van poliepen. Een mosdiertjeskolonie wordt gesticht door één mosdiertje, dat uit geslachtelijke voortplanting is ontstaan. Dit diertje kloont zichzelf ongeslachtelijk, waardoor er kopieën onstaan, die samen een kolonie vormen. Alle dieren in een kolonie zijn dus familie van elkaar. De diertjes kunnen zelfs riffen vormen; de zogenaamde ‘levende stenen’. Voorbeelden zijn zeevinger, bladachtig hoornwier en de harige vliescelpoliep.

De Nederlandse naam voor het phylum Bryozoa is “mosdiertjes”. Het zijn kleine kolonievormende diertjes die een kalkskelet vormen. In elk kamertje bevindt zich een diertje dat met tentakeltjes voedsel uit het water filtert. De kolonies kunnen zowel takvormig, waaiervormig of korstvormend zijn.

Ze komen voor in afzettingen uit het onder Klik hier voor info ! ordovicium tijdperk tot recent. Meestal zijn de kolonies vrij klein. De meeste soorten leven in zee, maar er zijn ook zoetwater soorten.

<klik

<continentenverplaatsing Nederland

Ontstaansgeschiedenis van de Noordzee en de Nederlanden 

Het verhaal begint in het Carboon, zo’n 300 miljoen jaar geleden. Op dat moment is er nog geen sprake van een Noordzee.

Tijdperken

tijdperk /    jaar   geleden/  kenmerken

Carboon 368-288 miljoen ontstaan delfstoffen (steenkool, aardgas, aardolie)
Perm 288-247 miljoen zoutafzettingen
Trias 247-211 miljoen Muschelkalk afzetting
Jura 211-143 miljoen vulkaan onder Waddenzee
Krijt 143-65 miljoen kalksteen, mergel
Tertiair 65-2,5 miljoen vorming Noordzeebekken
Kwartair 2,5 miljoen-nu ijstijden
Pleistoceen 2,5 miljoen – 10.000 jaar opkomst van de mens
Holoceen 10.000 jaar geleden-nu veenvorming

De planeet aarde ontstond ruim 4.5 miljard jaar geleden. De geologische tijdschaal wordt ingedeeld in het Precambrium en het Fanerozoïcum. Binnen het Fanerozoïcum, ruwweg de laatste 570 miljoen jaar, worden drie Era’s onderscheiden: Paleozoïcum (574 tot 247 miljoen jaar geleden), grofweg de tijd vóór de dinosaurussen, het Mesozoïcum (247 tot 65 miljoen jaar geleden), de tijd van de dinosurussen en Kenozoïcum (65 miljoen jaar geleden tot heden), de tijd ná de dinosaurussen.
Aan de hand van belangrijke geologische gebeurtenissen, zoals perioden van gebergtevorming, of opvallende veranderingen in de soorten fossielen hebben de geologen de tijdperken ingedeeld.

Periodes worden weer ingedeeld in tijdvakken. Zo wordt het Kwartair ingedeeld in de tijdvakken Pleistoceen (van 2.5 miljoen jaar geleden tot tienduizend jaar geleden) en Holoceen (van 10.000 jaar geleden tot nu).

Continentverplaatsing
Traag drijvend over het vloeibare binnenste van de aarde hebben de platen waar de continenten op liggen zich in de loop van de geologische geschiedenis over het aardoppervlak verplaatst. Aan de hand van allerlei geologische informatie (gesteentetypen, fossielen, magnetisme) heeft men de ligging van de continenten in het verleden in grote lijnen kunnen reconstrueren. Zo lag Scandinavië bijvoorbeeld tijdens het Siluur op de evenaar.

foto’s van Bryozoa (fossielen )

<klik

Vuursteen ontstaat als kiezelrijk materiaal wordt opgesloten in kalkhoudend slib en dit pakketje onder druk versteent. Tijdens dit proces kunnen allerlei organismen op een perfecte manier bewaard blijven, zoals de delicate takjes van mosdiertjes (Bryozoa)


Voorbeeld van een bryozo.

Bryozoën Klik hier voor vindplaatsen waar deze fossielen gevonden kunnen worden.
Ga naar de Determinatie pagina om foto’s van Bryozoa te bekijken.

http://www.fossiel.net/informatie/glossarium.php

GENKAPITAAL en verschillende GENOMEN

zie onder Genetica


1.-   Informatie toename 
_°De NOVO genen die voor eiwitten coderen bij de mens
¨
 GIST 
gist2  <—DOC

(eveneens  in   vermeld   document  )Repeat-induced point mutation (RIP) en evolutie door genduplicaties
Een artikel van Marnix Medema.

http://web.archive.org/web/20070226194902/www.nadarwin.nl/Gtica/rip.html   )

http://www.bio.davidson.edu/courses/genomics/2004/Bossie/MFYG.html

…….Door evolutie ontstaan nieuwe soorten.

Het is een proces dat onomkeerbaar lijkt te zijn. Een Britse genetica spoelde echter de evolutie terug. Ze maakte van bakkersgist een andere, nauw verwante gistsoort.

Evolutie teruggespoeld Soortbarrière van gist gewist = woensdag 5 maart 2003

Wetenschappers die evolutie bestuderen, lijken vaak op forensische detectives. Aan de hand van slechts enkele sporen scheppen ze een beeld van een bijzondere gebeurtenis. Het verschil met echt politiewerk is dat de evolutiewetenschappers vaak kijken naar gebeurtenissen van miljoenen jaren geleden.

Want wie wil bestuderen hoe en wanneer nieuwe soorten zich aftakken van hun voorouders, moet ver terug in de geschiedenis kijken. De Britse genetica Daniela Delneri bleef echter bij het heden en maakte zelf nieuwe soorten. Door wat te schuiven met het genetisch materiaal van bakkersgist, bracht ze twee gistsoorten weer bij elkaar. Het tijdschrift Nature publiceerde haar resultaten.

Van bakkersgist is bekend dat het in erfelijk opzicht erg lijkt op een andere gistsoort, die Saccharomyces mikatae heet.

Het enige verschil is dat sommige genen op andere plekken in het DNA staan.

Dit verschil is waarschijnlijk ooit ontstaan door een foutje tijdens de celdeling, waardoor relatief grote stukken DNA in zijn geheel werden verplaatst van de ene chromosoom naar een andere. Toch zijn de gevolgen daarvan zo groot dat de organismen verschillende soorten werden.

Delneri wilde dat verschil opheffen.

Ze recombineerde de genen van bakkersgist tot een nieuwe variant, die precies leek op de mikataegist. Haar onderzoek toont als eerste aan dat uitsluitend het verplaatsen van DNA een barrière tussen soorten kan opwerpen.

SOORTBEGRIP

Soorten verschillen van elkaar als ze geen vruchtbaar nageslacht produceren. Paarden en ezels kunnen bijvoorbeeld wel nakomelingen krijgen, namelijk muildieren en muilezels.

Deze dieren zijn zelf echter onvruchtbaar, en dus zijn paarden en ezels verschillende diersoorten.Delneri gebruikte dit onderscheid om te testen of haar gerecombineerde gist ook echt van dezelfde soort was als mikataegist

Ze kruiste beide en bepaalde de vruchtbaarheid van de sporen die ze vormden. Dertig procent bleek vruchtbaar te zijn.

Dat klinkt wellicht als een matige score, maar nazaten van twee verschillende soorten hebben doorgaans een veel lagere vruchtbaarheid. Namelijk ( nagenoeg ) nul procent.

Dat een derde van Delneri’s sporen vruchtbaar is geeft aan dat het verschil tussen de twee gistsoorten gedeeltelijk is opgeheven. Maar toch, als de nieuwe, gerecombineerde gist en de mikataegist echt van dezelfde soort zijn, zouden er enkel vruchtbare sporen uit ontstaan

De resultaten tonen in ieder geval aan dat

het onderscheid tussen verschillende soorten niet zwart-wit is

Het lijkt erop dat organismen ook slechts een beetje van dezelfde soort kunnen zijn.

Moeten we nu de evolutieleer herschrijven?

Delneri stelt dat DNA herschikken van grote invloed kan zijn op de manier waarop nieuwe soorten ontstaan.

Haar collega Ken Wolfe waarschuwt echter dat we niet al teveel waarde moeten hechten aan de recombinatie. Het werpt slechts een barrière op tussen verschillende soorten, zo stelt hij in een commentaar in dezelfde editie van Nature. Herschikken alleen is niet genoeg om nieuwe soorten te vormen.

Als voorbeeld geeft Wolfe aan dat sommige soorten slechts één gen van elkaar verschillen, zonder dat daar ooit DNA is herschikt.

Niettemin geven de resultaten van Delneri een nieuw raamwerk voor andere onderzoekers die soortvorming bestuderen, zo schrijft ze zelf. En wellicht ontstaat er dan ook meer duidelijkheid over de evolutie van de mens.

Veel van de zesduizend genen in gist hebben overeenkomsten met menselijk DNA.

Aschwin Tenfelde
D. Delneri et al.: Engineering evolution to study speciation in yeasts. In: Nature, vol.422, p.68, (6 maart 2003)
-àK. Wolfe: Speciation reversal. In: Nature, vol. 422, p.25, (6 maart 2003)

genome duplication “

VERDUBBELEN IS DE SLEUTEL

De genetische samenstelling van vele gistsoorten wordt gedetailleerd onder de loep genomen. Dat levert nuttige inzichten op in de evolutie van het leven.

André Goffeau van de Université Catholique de Louvain stelt in Nature dat het er steeds meer naar uitziet dat

de verdubbeling van genen of langere stukken van de chromosomen – of zelfs van volledige genensets – een sleutelmechanisme in de evolutie is………

http://www.sciencedaily.com/releases/2004/03/040308071448.htm

http://www.biomedcentral.com/news/20040701/01

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9192896&dopt=Abstract&holding=f1000

http://www.nature.com/nature/links/040701/040701-2.html

*
°
2.- GENOMEN   van verschillende  organismen

De koning van het erfgoed bij dieren is de amoebe

Biologen proberen al decennia lang  de grote van genomen te schatten
*In 1971, rapporteerden onderzoekers dat een italiaanse vleermuis species  Miniopterus, een genoom bezit dat de helft van het menselijke menselijke  genoom-kapitaal bezit ,
*Het Muntiacus, ( een aziatische hertensoort)zou ongeveer70%van het menselijke genoom-kapitaal bezitten .
*February 2001  ; werd aangekondigd dat het  menselijke genoom uit zowat 3 billion (chemical units of DNA,  )base-paren  bestaat.

In the animal kingdom, the relationship between genome size and evolutionary status is not clear.

One of the largest genomes belongs to a very small creature, Amoeba dubia. This protozoan genome has 670 billion units of DNA, or base pairs.

The genome of a cousin, Amoeba proteus, has a mere 290 billion base pairs, making it 100 times larger than the human genome.

A Sample of Species and Genome Size (in base pairs)

Amoeba dubia 
670,000,000,000
Amoeba proteus
290,000,000,000
Courtesy of Yuuji Tsukii
Bufo bufo
6,900,000,000
Homo sapiens
2,900,000,000
Copyright 2001, Mary S. Gibbs, GNN
Muntiacus muntjak vaginalis
2,521,500,000
Boa constrictor
2,100,000,000
Rhinolophus ferrumequinum
1,929,400,000
Plasmodium falciparum
25,000,000
Courtesy of NLM
Human immunodeficiency virus type 1
19,750
Copyright 2001, Mary S. Gibbs, GNN
 Source: Database of Genome Sizes (Center for Biological Sequence Analysis)

Genome Sizes

The genome of an organism is the complete set of genes specifying how its phenotype will develop (under a certain set of environmental conditions). In this sense, then, diploid organisms (like ourselves) contain two genomes, one inherited from our mother, the other from our father.

Table of Genome Sizes (haploid)
Base pairs Genes Notes
Phi-X 174 5,386 10 virus of E. coli
Human mitochondrion 16,569 37
Epstein-Barr virus (EBV) 172,282 80 causes mononucleosis
Nanoarchaeum equitans 490,885 552 This parasitic archaean has the smallest genome of a true organism yet found.
nucleomorph of Guillardia theta 551,264 511 all that remains of the nuclear genome of a red alga (eukaryote) engulfed long ago by another eukaryote
Mycoplasma genitalium 580,073 483 three of the smallest true organisms
Ureaplasma urealyticum 751,719 652
Mycoplasma pneumoniae 816,394 680
Chlamydia trachomatis 1,042,519 936 most common sexually-transmitted disease (STD) bacterium in the U.S.
Rickettsia prowazekii 1,111,523 834 bacterium that causes epidemic typhus
Treponema pallidum 1,138,011 1,039 bacterium that causes syphilis
Mimivirus 1,181,404 1,262 A virus (of an amoeba) with a genome larger than the six cellular organisms above
Rickettsia conorii 1,268,755 1,374 causes Mediterranean spotted fever
Pelagibacter ubique 1,308,759 1,354 smallest genome yet found in a free-living organism (marine 慣-proteobacterium)
Borrelia burgdorferi 1.44 x 106 1,738 bacterium that causes Lyme disease [Note]
Aquifex aeolicus 1,551,335 1,749 bacterium isolated from a hot spring in Yellowstone National Park
Thermoplasma acidophilum 1,564,905 1,509 an archaean that lacks a cell wall
Campylobacter jejuni 1,641,481 1,708 frequent cause of food poisoning
Helicobacter pylori 1,667,867 1,589 chief cause of stomach ulcers (not stress and diet)
Methanococcus jannaschii 1,664,970 1,783 These unicellular prokaryotes look like typical bacteria but their genes
are so different from those of either bacteria or eukaryotes that they are
classified in a third kingdom: Archaea.
Aeropyrum pernix 1,669,695 1,885
Pyrococcus horikoshii 1,738,505 1,994
Methanobacterium
thermoautotrophicum
1,751,377 2,008
Haemophilus influenzae 1,830,138 1,738 bacterium that causes middle ear infections
Thermotoga maritima 1,860,725 1,879 marine bacterium
Streptococcus pneumoniae 2,160,837 2,236 the pneumococcus
Archaeoglobus fulgidus 2,178,400 2,437 another member of the Archaea
Neisseria meningitidis 2,184,406 2,185 Group A; causes occasional epidemics of meningitis in less developed countries.
Neisseria meningitidis 2,272,351 2,221 Group B; the most frequent cause of meningitis in the U.S.
Encephalitozoon cuniculi 2,507,519 1,997 (plus 69 RNA genes); a parasitic eukaryote.
Propionibacterium acnes 2,560,265 2,333 causes acne
Listeria monocytogenes 2,944,528 2,926 2,853 of these encode proteins; the rest RNAs
Deinococcus radiodurans 3,284,156 3,187 on 2 chromosomes and 2 plasmids; bacterium noted for its resistance to radiation damage
Synechocystis 3,573,470 4,003 a marine prokaryote, one of the cyanobacteria (“blue-green algae”)
Vibrio cholerae 4,033,460 3,890 in 2 chromosomes; causes cholera
Mycobacterium tuberculosis 4,411,532 3,959 causes tuberculosis
Mycobacterium leprae 3,268,203 1,604 causes leprosy
Bacillus subtilis 4,214,814 4,779 another bacterium
E. coli 4,639,221 4,377 4,290 of these genes encode proteins; the rest RNAs
Agrobacterium tumefaciens 4,674,062 5,419 Useful vector for making transgenic plants; shares many genes with Sinorhizobium meliloti
Salmonella enterica var Typhi 4,809,037 4,395 + 2 plasmids with 372 active genes; causes typhoid fever
Salmonella enterica var Typhimurium 4,857,432 4,450 + 1 plasmid with 102 active genes
Yersinia pestis 4,826,100 4,052 on 1 chromosome + 3 plasmids; causes plague
Schizosaccharomyces pombe 12,462,637 4,929 Fission yeast. A eukaryote with fewer genes than the five prokaryotes below.
E. coli O157:H7 5.44 x 106 5,416 strain that is pathogenic for humans
Ralstonia solanacearum 5,810,922 5,129 soil bacterium pathogenic for many plants; 1681 of its genes on a huge plasmid
Pseudomonas aeruginosa 6.3 x 106 5,570 Increasingly common cause of opportunistic infections in humans.
Streptomyces coelicolor 6,667,507 7,842 An actinomycete whose relatives provide us with many antibiotics
Sinorhizobium meliloti 6,691,694 6,204 The rhizobial symbiont of alfalfa. Genome consists of one chromosome and 2 large plasmids.
Saccharomyces cerevisiae 12,495,682 5,770 Budding yeast. A eukaryote.
Cyanidioschyzon merolae 16,520,305 5,331 A unicellular red alga.
Plasmodium falciparum 22,853,764 5,268 Plus 53 RNA genes. Causes the most dangerous form of malaria.
Thalassiosira pseudonana 34.5 x 106 11,242 diatom. Plus 144 chloroplast and 40 mitochondrial genes encoding proteins
Neurospora crassa 38,639,769 10,082 Plus 498 RNA genes.
Caenorhabditis elegans 100,258,171 19,427 The first multicellular eukaryote to be sequenced.
Arabidopsis thaliana 115,409,949 ~28,000 a flowering plant (angiospermSee note.
Drosophila melanogaster 122,653,977 13,379 the “fruit fly”
Anopheles gambiae 278,244,063 13,683 Mosquito vector of malaria.
Dogs 2.4 x 109 19,300
Humans 3.3 x 109 20,000–25,000 [Link to more details.]
Tetraodon nigroviridis (a pufferfish) 3.42 x 108 27,918 Although Tetraodon seems to have about the same number of genes as we do, it has much less “junk” DNA so its total genome is about a tenth the size of ours.
Rice 3.9 x 108 37,544
Amphibians 109 – 1011 ?
Psilotum nudum 2.5 x 1011 ? Note

Note: The gene total for Borrelia burgdorferi is based on 853 genes on its single chromosome (of 910,724 base pairs) plus 430 genes on 11 of the 17 plasmids it contains.

Arabidopsis thaliana is a plant (in the mustard family) that has the smallest genome known in the plant kingdom and for this reason has become a favorite of plant molecular biologists. The sequences of two of its five chromosomes (#2 and #4) were published in December 1999. The others were reported in December 2000.

Even though Psilotum nudum (sometimes called the “whisk fern”) is a far simpler plant than Arabidopsis (it has no true leaves, flowers, or fruit), it has 3000 times as much DNA. No one knows why, but 80% or more of it is repetitive DNA containing no genetic information. This is also the case for some amphibians, which contain 30 times as much DNA as we do but certainly are not 30 times as complex.

The total amount of DNA in the haploid genome is called its C value. The lack of a consistent relationship between the C value and the complexity of an organism (e.g., amphibians vs. mammals) is called the C value paradox.

How many genes does it take to make an organism?

The scientists at The Institute for Genomic Research (TIGR) who determined the Mycoplasma genitalium sequence followed this work by systematically destroying its genes (by mutating them with insertions) to see which ones are essential to life and which are dispensable. Of the 480 protein-encoding genes, they concluded that only 265–350 of them are essential to life. More recently, they have refined these figures to 387 protein-encoding genes and 43 RNA-encoding genes.

Van vegetarische wesp tot ‘killer bee’

De bij ging in 100 miljoen jaar de hele aarde over

 Een mannetjesexemplaar van de rosse metselbij. Naar schatting leven op aarde zestien- tot twintigduizend bijensoorten. (
Een mannetjesexemplaar van de rosse metselbij. Naar schatting leven op aarde zestien- tot twintigduizend bijensoorten. (   Foto Natura)

26 oktober 2006

Sander Voormolen

De honingbij evolueerde in Afrika en is daarna twee keer overgestoken naar Eurazië, waardoor de bijenvolken in Oost- en West-Europa nog altijd duidelijk genetisch verschillen.
Een groot internationaal consortium van wetenschappers heeft het complete DNA van de de honingbij in kaart gebracht. Dit is belangrijk omdat de wetenschap daarmee hoopt te ontrafelen hoe het sociale leven en het geavanceerde gedrag van dit insect zijn vastgelegd in zijn genen.
De publicatie van het genoom van de honingbij is door de belangrijke wetenschappelijke tijdschriften aangegrepen om nu eens flink uit te pakken over bijen in het algemeen. De vakbladen Nature, Science, Genome Research en de Proceedings of the National Academy of Sciences produceren vandaag een ware lawine aan wetenschappelijke artikelen over het onderwerp.In Science rapporteren onderzoekers vondst van het oudste bijenfossiel tot nu toe; een in barnsteen geconserveerd exemplaar van de uitgestorven soort Mellitosphex burmensis van honderd miljoen jaar oud. Het fossiel staat dicht bij het begin van de evolutie van bijen, waarvan men aanneemt dat die pas succesvol werden na de grote expansie van bloeiende planten die iets langer dan honderd miljoen jaar geleden de dominante positie van conifeerachtige planten overnamen.Het fossiel, dat werd gevonden in een mijn in de Hukawng-vallei in het noorden van Myanmar, heeft de kenmerken van een bij (zoals vertakte haren op heel het lijf) maar lijkt daarnaast sterk op wespen. Volgens de onderzoekers is dat een duidelijke aanwijzing dat bijen zijn geëvolueerd uit wespen, en hun carnivore leefwijze hebben ingewisseld voor een vegetarisch menu van nectar en stuifmeel. Een succesvolle overstap: er leven tegenwoordig naar schatting tussen de 16.000 en 20.000 bijensoorten op aarde.De honingbij is er daar slechts één van, maar wel één die mede dankzij de mens een wereldwijde verspreiding kent. Omdat de nauwste verwant van de honingbij Apis cerana leeft in Centraal Azië ging men ervan uit dat hij hier ontstaan moest zijn. Maar uit genetisch onderzoek in een ander artikel in Science blijkt dat de honingbij in tropisch Afrika evolueerde en daarvandaan minstens tweemaal migreerde naar Centraal-Azië en Noord-Europa. Daaruit werden de volken gedomesticeerd die nu onze honing leveren.De honingbij kwam nog een derde keer uit Afrika, nu met hulp van de mens en met minder gelukkige gevolgen. In 1956 werd de Afrikaanse ondersoort van de honingbij (Apis mellifera scutellata) die leefde op de savannen opzettelijk geïntroduceerd in Brazilië om de honingproductie te stimuleren. Het liep verkeerd af; de Afrikaanse immigrant hybridiseerde met eerder geïntroduceerde Europese honingbijen en ontwikkelde zich tot een uiterst agressieve steeklustige bij; de ‘killer bee’. De killer bee begon een opmars naar het noorden en bereikte in de jaren negentig ook de Verenigde Staten waar de soort een plaag werd en de bijenvolken van imkers verdrong. Genetisch is de killerbee een mengsel van Euraziatische en Afrikaanse origine.Andere artikelen in de ‘bijengolf’ gaan in op genetische details. Zo berichten onderzoekers in het blad Proceedings of the National Academy of Sciences over de genetische veranderingen die ten grondslag liggen aan de veranderingen in het gedrag van bijenwerksters. In de eerste fase van hun ongeveer veertig dagen durende leven werken zij in de korf en verzorgen zij het broed in de raten, maar later vliegen ze uit om te foerageren. De onderzoekers vonden duizenden genen die verschillen in de hersenen van jonge en oude bijen. Ze ontdekten echter ook dat die verschillen niet alleen afhankelijk zijn van de leeftijd, maar ook beïnvloed kunnen worden door de omgeving of de ervaring van de bij. Dat komt overeen met eerdere bevindingen dat werksters zich sneller of langzamer kunnen ontwikkelen, afhankelijk van de behoefte van de kolonie.Andere artikelen richten zich bijvoorbeeld op het aantal genen voor geurreceptoren (163, twee keer zoveel als fruitvliegjes en malariamuggen) of de identificatie van neuropeptiden (kleine eiwitten in de hersenen) van honingbijen. Tot nu toe waren er slechts drie neuropeptiden bekend van de honingbij, maar dat arsenaal is nu uitgebreid naar meer dan honderd, dankzij de nieuwe genoominformatie.Opvallend is dat onderzoekers in verschillende artikelen elkaar soms tegenspreken. De wetenschappers van het Honeybee Genome Sequencing Consortium schrijven in Nature dat de honingbij relatief langzaam evolueerde in vergelijking met het fruitvliegje en de malariamug. Maar in het tijdschrift Genome Research komen onderzoekers onder leiding van Martin Beye van de Heinrich Heine Universiteit in Düsseldorf tot de tegenovergestelde conclusie: de honingbij is één van de snelst geëvolueerde organismen.Volgens Beye en zijn collega’s heeft de honingbij, sinds de aftakking van de hommels van zo’n 60 miljoen jaar geleden, in zijn genoom het hoogste niveau van recombinatie doorgemaakt van alle tot nu toe onderzochte diersoorten. Volgens onderzoekers zou deze versnelde evolutie een reactie zijn op het leven in een kolonie waarbij de koningin het enige vrouwtje is dat nageslacht voortbrengt. Meer recombinatie betekent een hogere genetische diversiteit en dat versnelt op zijn beurt de evolutie van selectief voordelige eigenschappen.De tegengestelde conclusies van beide groepen onderzoekers zijn te verklaren doordat zij ieder op een andere manier naar het genoom hebben gekeken; de een op het niveau van genen en de ander op het niveau van eenletterveranderingen in de genetische code
Complete genoom honingbij ontrafeld

De genenkaart van de honingbij (Apis mellifera) is de derde van een insect, na het fruitvliegje en de malariamug.

Maar dit keer gaat het om een zeer bijzonder insect, dat een complex gedrag en sociale organisatie kent. Honingbijen leven in kolonies met wel tienduizend individuen, maar alleen de koningin draagt bij aan de voortplanting en legt dagelijks tot 2000 eitjes. De kolonies werken efficiënt dankzij de verdeling van arbeid en uitstekende onderlinge communicatie, met als hoogtepunt de beroemde bijendans waarmee de werksters elkaar informeren over goede voedselplekken.

Dat sociale leven van de honingbij is diep verankerd in de genen, zo blijkt uit de publicatie van het complete genoom  in het Britse wetenschappelijke tijdschrift Nature. Zo hebben de bijen een groot arsenaal aan genen voor geurreceptoren die een belangrijke rol spelen bij de communicatie via feromonen tijdens de bijendans. Ook hebben ze een set van negen genen die coderen voor de eiwitten die de zogeheten koninginnengelei vormen. De gelei die geproduceerd wordt in de kop van werksters is cruciaal voor het instandhouden van de kastenverdeling in het bijenvolk.

In sommige opzichten lijken de genen van de honingbij zelfs meer op die van gewervelde dieren dan op die van andere insecten. Het gaat daarbij onder meer om klokgenen die het dag-nachtritme bijhouden en om genen voor RNA-interference, de kleine moleculen die de activiteit van andere genen kunnen beïnvloeden.

Veel van deze kleine RNA’s bleken specifiek voor de kaste of het stadium van de bij, en spelen hierin mogelijk een belangrijke regulerende rol. Niet voor niet wordt in Nature ook de vermaarde bijenonderzoeker Karl von Frisch geciteerd: ‘Het leven van bijen is een magische bron. Hoe meer je er van aftapt, hoe meer er blijkt af te tappen.’

26 oktober 2006

carl Zimmer ; The Loom

http://scienceblogs.com/loom/2006/10/25/to_bee_1.php

Honingbij Genoom

In dit tijdperk van de technologische vooruitgang in de biologie,kunnen we veel te leren vanuit een beter begrip van de genetische coderingen . We horen in het nieuws over het onderzoek naar genen die in verband staan met kanker, obesitas, en andere gezondheid gerelateerde onderwerpen.

Echter
Dezelfde technieken kunnen worden gebruikt om insecten en andere organismen bestuderen .
Maar de terminologie is overweldigend en niet in een keer te vatten .
We bekijken hieronder een paar van de belangrijkste factoren binnen de honingbij genetica, enwe bespreken vervolgens een aantal van de inzichten verkregen bij de studie van het honingbij genoom.
honingbij en DNA

Bee foto door Zachary Huang

Honingbij genetica

Genetica is de studie van de variabele eigenschappen van organismen en hoe ze worden doorgegeven van de ene generatie naar de volgende.

Genen zijn eenheden van DNA die fungeren als een blauwdruk voor deze eigenschappen.Hoewel de mens minstens 7000 jaar geledenis begonnen met het houden van bijen , was het pas midden de jaren 1850 dat de mensen begonnen de honingbij voortplanting en haar genetica te begrijpen, zodat ze vervolgens geicht konden fokken naar wenselijke eigenschappen toe . De meeste bijen in de korf zijn wijfjes , en de koningin is verantwoordelijk voor alle reproductie.
Een paar unieke aspecten van de honingbij genetica werden gevonden in het onlangsontrafels bijen genoom ; die kunnen ons meer vertellen over de eusociale trekken en de biologie van de bij socialiteit
In een honingbij kolonie , is de koningin is verantwoordelijk voor alle reproductie en doet zij alleen aan het ei-leggen in de korf.
Vrouwelijke werknemers doen al het werk in de korf en het verzamelen van voedsel buiten de korf.
Mannelijke darren zijn minder talrijk en ze dragen weinig functioneel bij aan het a-sexuele korfleven

Honingbijen (en de rest van de Hymenoptera: solitaire bijen, mieren en wespen) hebben een genetisch systeem dat anders is dan het onze : de meeste insecten zijn haplodiploid = Dat is een systeem waarbij vrouwen twee kopieën bezitten van elk chromosoom, maar de mannetjes slechts één exemplaar..
Haplodiploidie verhoogt de onderlinge verwantschap tussen broers en zussen en is gerelateerd ( de eusociale insekten ) aan de maatschappelijke arbeidsverdeling.
Vrouwelijke honingbijen hebben een volledige chromosomen -set (een set van elke ouder) en zijn derhalve diploïde . Mannetjes echter worden gevormd uit onbevruchte eieren en zijn haploïde = slechts een exemplaar van elk chromosoom.
Koninginnen zijn in staat al dan niet een bevrucht ei te leggen….Ze zijn ook in staat om gedurende lange tijd bruikbaar sperma op te slaan van vorige paringen.Ze hebben dus geen voortdurende bevruchter op korte termijn nodig … Op deze manier, beheersen de koninginnen het beheer van de sex-ratio in de korf.

diagram van chromosomen in honing bijen

Bee foto’s van Zachary Huang

Deze figuur toont twee sets chromosomen voor de duidelijkheid.

Diploïde vrouwtjes hebben 16 paar, of 32, chromosomen, en haploïde mannetjes hebben slechts 16 enkele chromosomen.

Honingbij genoom

Genomica is de studie van DNA op het niveau van de chromosomale grote clusters van genen of het gehele genoom tegelijkertijd.

Een genoom is het geheel van genetisch materiaal van een individueel organisme.Om een volledige genoomsequentie te krijgenmoeten we alle genetische code opeenvolgingen voor het betreffende organisme “sequenzen “.
Chromosomen zijn lange strengen van DNA dat een groot aantal coderende genen /en gen-programma’s draagt . Het ‘alfabet’ voor de code bevat slechts vier letters: A, T, C en G.
Bij het “sequensen ” van een genoom, bepalen we de gehele DNA code voor alle chromosomen.Hoe gebeurd dat ?
Nadat het DNA wordt geëxtraheerd, wordt het§ gebroken in kleine stukjes, die vervolgens worden worden ge-sequenced. Daarna wordt met behulp van een computationeel proces de “sequensed ” kleine stukjes weer in elkaar gezet met behulp van de gevonden overlappende secties in de verschillende stukjes

diagram van hoe een genoom gesequenced


Waarom werd de honingbij gekozen ?

Het primaire motief was om het mechanismen die ten grondslag liggen aan het sociaal gedrag ( en andere aspecten van de bijen biologie.)te begrijpen
Er is geen speciaal gen dat bepaalt of een bij uitgroeit tot een koningin of een werkster : De werkverdelingen in de bijenkorf worden niet bepaald door de genetische make-up.
Koninginnen zijn fenotypische resultaten van larven die gevoed werden met grote hoeveelheden van een stof die koninginnebrij wordt genoemd . Koninginnen zijn groter zijn dan werkster en zijn verantwoordelijk voor alle voortplanting in de korf.Verder zijn er geen specifieke genen die de verschillende taken van de werksters aan de verschillende taken die regelen : die hanghen onder andere af van de leeftijd van het insekt = na ongeveer een week als imago , is er een overgang in het gedrag die leid tot het uitvoeren van foeragerende (verzamelen van voedsel) taken buiten de korf.
Andere taken die kunnen worden gedaan binnen de kolonie onder meer het bewaken van de bijenkorf en het verwijderen van dode bijen uit de korf gebeuren op latere leeftijd .Er zijn iets meer dan 10.000 genen in het genoom van de honingbij, maar dit is waarschijnlijk een lichte onderschatting van de werkelijke totaal.
Van de totale voorspelde genen, zijn er 1052 specifiek zijn voor de honingbij ze hebben ook een groot aantal gemùeenschappelijk met andere insecten waarvan de genoom sequentie al bekend was : de fruitvliegDrosophila melanogaster en de malariamug Anopheles gambiae, Aedes aegypti, de gele koorts mug en Bombyx mori, de zijdevlinder. Men is bezig met het sequensen van HET LELIEHAANTJE , DE Mensen – luis, en de erwten bladluis. (zwarte luis )
Het aantal genoom sequencing projecten NAM/Neemt sterk toe naarmate de technologie steeds sneller en goedkoperWERD .
Vergelijkende genomica is een opkomend gebied dat tot doel heeft veel vragen te beantwoorden over evolutie.Aedes egypti mugmale zijderups
Links: Aedes aegypti mug (foto van USDA)
Rechts: Bombyx mori mot (foto door Kevin Wanner)Veel genen- “families” zijn onderzocht bij de honingbij, en veel van die families werden vergeleken met hun evenknieen in de fruitvlieg en muggen.
Hier zijn enkele hoogtepunten van wat we hebben geleerd van het honingbij genoom, (maar het is zeker geen uitputtende lijst.)

Geur en Smaak

Geur

Geloof het of niet, insecten “ruiken ” ​​met hun antennes. Speciale eiwitten in de antennes( genoemd reukstof- receptoren )laten het insect chemicaliën in het milieu herkennen. De mogelijkheid om geuren waar te nemen is erg belangrijk bij de insecten: ze moeten immers in staat zijn om mogelijke voedselbronnen te ruiken, een partner te vinden(feronomen ) , en hun vijanden te vermijden.

bijen gebruiken antennes te ruiken
Insecten gebruiken antennes te ruiken.
Foto’s van Zachary Huang

In vergelijking met de fruitvlieg en muggen, bezitten bijen meer dan tweemaal zoveel genen die coderen voor deze geurstof-detector eiwitten. Inderdaad, bijen kunnen verschillende feromonen en diverse bloemen geuren , waarnemen. Ze kunnen zelfs hun familieleden, nest(geur) en de koningin herkennen dmv de geur.

Smaak

smaak is een andere methode waarmee chemicaliën in het milieu worden waargenomen . Honingbijen hebben slechtszo’n 15% van het aantal smaakreceptoren in vergelijking met fruitvliegjes en malariamuggen.

Mogelijke verklaringen voor het beperkte aantal smaakreceptoren is het feit dat larvale bijen worden gevoed door de volwassen werknemers en niet hoeven te rekenen op smaak signalen om giftige chemische stoffen te vermijden.
Bovendien, voeden bijen zich met stuifmeel en nectar, die worden geproduceerd door hun waard – planten als lok- ” voedsel voor bestuivers”, en dus zelden giftige chemicaliën bevatten.
bee drinken suikerwater
Een bij proeft uiker water
Foto door Zachary Huang

Ontgifting

Insecten evolueren routinematig weerstand tegen de verdedigings chemicaliën (en zelfs insecticiden)van hun waard- planten.

Inderdaad, sommige genen die verantwoordelijk zijn voor het ontgiften van het verdedigingsmechanisme van planten chemicaliën , zijn betrokken bij resistentie tegen insecticiden.
Honingbijen bezitten minder ontgiftings-genen dan de fruitvlieg of malariamug , waardoor ze gevoeliger zijn voor insecticiden in het milieu. Beperking van het gebruik van insecticiden in de tuin zal helpen ter beschermen van de bijen.

Immuniteit

Honingbijen hebben minder immuniteits-genen dan de andere insecten. Dit is interessant gezien het feit dat de bijen worden blootgesteld aan pathogenen in een drukke omgeving. Er wordt gesuggereerd dat bijen misschien de infectie te voorkomen door “verzorging” en andere sociaal gedrag.(zoals grooming ? )

Populatiegenetica

Een gebruik van een genoom is afgeleid van de geschiedenis van de soort. De honingbij genoom werd gescand op single nucleotide polymorfismen (SNPs): mutaties die een letter van de DNA-sequentie te veranderen op een moment. Plaatsen waar SNPs kunnen optreden in kaart worden gebracht op de chromosomen en worden gebruikt voor vele doeleinden. Bijvoorbeeld, een analyse van deze SNP’s toonden aan dat de bijen op zijn minst twee oude migraties had van Afrika en in Europa. Een ander gebruik van deze SNPs is de studie van de ‘killer’ Afrikaanse bijen, die naar Zuid-Amerika geïntroduceerd in 1954. Deze bijen zijn nu hybridiseren met bijen in Midden-en Zuid-Amerika.

Tot slot, alleen maar omdat we hebben allemaal van de volgorde voor een organisme betekent niet dat we hebben gevonden alle informatie moet het nog aan te bieden. Er zijn veel genen met onbekende functies, en sommige genen misschien niet eens zijn nog niet gevonden. Er zijn nog veel vragen te beantwoorden!

Woordenlijst

Diploïde: gepaarde complementaire set chromosomen
Haploïde: ongepaarde, enkele set chromosomen
Chromosoom lang stuk DNA dat vele genen bevat, worden vervoerd genen in deze eenheden
Gene: erfelijke eenheid van DNA dat codeert voor een specifiek eiwit
DNA: Deoxyribonucleïnezuur. Een dubbelstrengs molecuul dat eiwitten codeert. Code is een combinatie van A, T, C en G.
Feromonen: een chemische stof die door een organisme van een soort te communiceren met een lid van dezelfde soort
Resistance: een eigenschap waar een organisme wordt minder beïnvloed door iets dat moet worden hinder ondervindt. Bijvoorbeeld, sommige insecten resistent zijn tegen bepaalde insecticiden, waardoor deze insecticiden niet tegen insecten te doden.

http://www.bijendans.nl/1921339.htm

Nature : Honeybee genome

Image: Jeff Pettis, USDA-ARS Bee Research Lab

In this focus

Honeybees have fascinating social structure and advanced societies despite having brains that are five orders of magnitude smaller than humans. An international consortium here reports the genome sequence of the honeybee. Initial analysis of gene content and evolution yields insight into how they accomplish such complex organisation and behaviours such as the famous ‘waggle dance’. This special Nature web focus celebrates the publication of the honeybee genome with video interviews and news analysis of the primary research papers, and a comprehensive archive of all matters Apis mellifera.

Insights into social insects from the genome of the honeybee Apis mellifera Free access

The Honeybee Genome Sequencing Consortium et al. /Nature 443, 931-949 (26 October 2006) doi:10.1038/nature05260

Abstract | Full Text |  PDF   : http://www.nature.com/nature/journal/v443/n7114/pdf/nature05260.pdf

Supplementary Information  http://www.nature.com/nature/journal/v443/n7114/extref/nature05260-s1.pdf

Genoom mijlpalen
1975 Bacterievirus MS2, eerste organisme (RNA-virus) (3569 baseparen= bp)
1977 Bacteriofaag PhiX174 , eerste DNA-virus (5386 bp)
1990 Humane cytomegalovirus (229.354 bp)
1995 Haemophilus influenzae, eerste bacterie (1,8 miljoen bp)
1996 Bakkersgist (12 miljoen bp)
1997 Escherichia coli (4,6 miljoen bp)
1998 Tuberculosebacterie (4,4 mln bp)
1999 Rondworm, eerste meercellige dier (97 miljoen bp)
2000 Zandraket, eerste plant (125 mln bp)
2000 Fruitvliegje (120 miljoen bp)
2001 Mens (3 miljard bp)
2001 Muis (2,6 miljard bp)
2004 Rat (2,75 miljard bp)
2005 Chimpansee (3 miljard bp)
2006 Zwarte balsempopulier (485 mln bp)
2006 Honingbij (236 miljoen bp)

Leuvense wetenschappers ontrafelen hersenen van

honingbij

http://www.kuleuven.be/nieuws/berichten/2006/pb26_10_2006.html

Het onderzoek kan ook bijdragen tot wetenschap over de mens.

Wetenschappers van het Laboratorium voor Ontwikkelingsfysiologie, Genomics en Proteomics van de K.U.Leuven zijn er samen met collega’s van Urbana (VS) in geslaagd een 100-tal neuropeptiden in het centraal zenuwstelsel van de bijenhersenen te detecteren. Deze vondst zal bijdragen tot een beter begrip van hun sociaal gedrag, weerstand tegen ziekten en verouderingsproces, zaken die ook relevant zijn voor de mens.

Peptiden geïdentificeerd
Het Leuvense labo werkt binnen het Honey Bee Genome Sequencing Consortium dat meer dan 170 wetenschappers uit 16 landen verenigt en onlangs het genoom van de honingbij ontrafelde.

Met behulp van gesofisticeerde massaspectrometische technologie챘n werden thans een 100-tal peptiden ge챦dentificeerd. Het gaat om kleine eiwitjes die betrokken zijn bij ongeveer alle belangrijke levensprocessen zoals vervelling, metamorfose, voeding, biologische klok, voortplanting, gedrag. (belga)
De genetische kaart van de honingbij is af. Daarmee kunnen wetenschappers onder andere meer te weten komen over het menselijke brein. Want bijen blijken opvallend veel met ons gemeen te hebben.De honingbij (Apis mellifera, zie afbeelding) is het vierde insect waarvan wetenschappers het complete genoom – de combinatie van alle erfelijke factoren – hebben weten te ontrafelen. De fruitvlieg, mug en zijdemot gingen hem voor. In het DNA van de bij vonden de onderzoekers opvallende overeenkomsten met het genetische materiaal van mensen en andere zoogdieren.Net als de mens heeft de honingbij zich vanuit Afrika naar Europa verspreid. Daar hebben ze zich in twee verschillende populaties opgesplitst die genetisch van elkaar verschillen. Uit het DNA blijkt dat die meer verwant zijn aan hun Afrikaanse soortgenoten dan aan elkaar.Biologische klok
Een andere eigenschap die bijen met mensen en bepaalde zoogdieren delen, is het bezit van een interne biologische klok. Ook vliegen hebben er een, maar de biologische klok van bijen heeft meer overeenkomsten met die van mensen en zoogdieren dan met die van de vlieg. De bijenklok zorgt ervoor dat de diertjes een besef van tijd hebben, maar ook beter kunnen navigeren en taken kunnen verdelen.Daarnaast speelt de biologische klok van de honingbij een cruciale rol bij de beroemde ‘danstaal’: een ingenieus communicatiesysteem dat de werksters van een populatie gebruiken om elkaar informatie door te geven over voedselbronnen. De hersenen van honingbijen blijken over 36 verschillende genen te beschikken, waarvan er 33 nog niet eerder waren ontdekt.Verder hebben deze insecten honderd neuropeptiden: moleculen die zowel bij bijen als bij mensen de hersenactiviteit reguleren. In vergelijking met de fruitvlieg en de mug, blijkt de honingbij over veel meer genen te beschikken die betrekking hebben op de reukzin. Er zijn er echter juist veel minder betrokken bij smaak. De bij is dus gespecialiseerd in geur, en dat is logisch als het je taak is om van bloem tot bloem te vliegen. Verder blijken bijen in elke levensfase een ander genenpakket in te schakelen, en blijken de diertjes – net als mensen en gewervelde dieren – in staat te zijn om genen aan- en uit te schakelen. Vliegen en muggen kunnen dat niet.Evolutieschakel Fossiel
Maar er is nog meer nieuws over bijen.Wetenschappers hebben namelijk de oudste bij ooit gevonden. Het exemplaar van maarliefst honderd miljoen jaar oud is in gefossiliseerde vorm bewaard gebleven in een stuk amber.Het blijkt een kruising tussen een bij en een wesp te zijn en is slechts drie millimeter lang. Er zijn ook stuifmeelkorrels aangetroffen, wat er op wijst dat deze verre voorouders van de hierboven beschreven Apis mellifera ook al druk doende waren met de bloempjes.Bijzonder aan het fossiel is dat het minstens 35 tot 45 miljoen jaar ouder is dan elk ander bijenfossiel dat ooit gevonden is.

De vondst bevestigt de bestaande theorie챘n over de evolutie van bijen. Experts geloven namelijk dat deze van pollen afhankelijke insecten afstammen van vleesetende bij-achtige wezens.

Het fossiel geeft wetenschappers een vrij duidelijk beeld van wanneer de moderne bijensoort die wij kennen is ge챘volueerd.

Wat moet je in huis hebben om een complexe samenleving op poten te zetten? Nu de genenkaart van de honingbij af is, komt een antwoord in zicht. Veel talent voor geursignalen in elk geval, en een geavanceerd systeem om genen mee aan en uit te zetten.

Sluit dit venster

De honingbij komt over de hele wereld voor, mede dankzij de mens. (Zachary Huang)

Het lijkt misschien een raar idee, maar u bent verwant aan alles wat leeft. Zo ook aan de honingbij. De laatste gemeenschappelijke voorouder van mens en honingbij moet zo’n zeshonderd miljoen jaar geleden in zee geleefd hebben. Honderd miljoen jaar geleden, toen er nog lang geen mensachtige wezens op de planeet rondliepen, waren er al wel bijen, blijkt uit een nieuw ontdekt bijenfossiel.

George Poinar junior en Bryan Danforth presenteren in Science een drie millimeter lang bijtje dat al honderd miljoen jaar in barnsteen opgesloten zit. Een mannetje, zien de onderzoekers aan het aantal segmenten waaruit zijn voelsprieten bestaan. Uit zijn uiterlijk, met vertakte haartjes waar nog enkele stuifmeelkorrels aan kleven, blijkt verder dat het beestje door het leven ging als bevruchter van bloemen. Of deze soort een sociaal leven in kolonies leidde, maakt het fossiel niet duidelijk.

Sluit dit venster

Slechts drie millimeter groot is dit honderd miljoen jaar oude bijtje. (Science)

Sluit dit venster

Als tekening is hij wat duidelijker te zien (Science)

Vroegste bij had nog kenmerken van wesp.
In barnsteen van ongeveer 100 miljoen jaar oud (Vroeg-Krijt) is een insect aangetroffen dat door de onderzoekers is gekenmerkt als een bij. Daarmee gaat de geschiedenis van de bijen 35-45 miljoen jaar verder terug dan uit eerdere vondsten viel op te maken. Het gaat dan ook om een primitieve vorm, die bovendien veel gemeen heeft met wespen.
 Een en ander sluit overigens perfect aan bij al bestaande hypotheses over het ontstaan van bijen en wespen. Dergelijke hypothese stellen onder meer dat de – van bloempollen afhankelijke – bijen afstammen van vleesetende wespen. Het stuk barnsteen met de bij is afkomstig uit een mijn in het noorden van Birma. De bij, waarvoor een nieuwe familie (Melittosphecidae) in het leven is geroepen, heeft de naamMelittosphex burmensis gekregen.
( zie hierboven in bericht 3 de foto  uit science )
Hij is ongeveer 3 mm groot (klein in vergelijking met de meeste recente bijen, hoewel er ook nu soorten voorkomen van gelijke grootte), wat aansluit bij de recente kennis omtrent de vroegste bloemen: die dateren ook uit het Vroeg-Krijt en die waren ook klein (de eerdere landvegetatie werd gedomineerd door coniferen, waarvan het zaad door de wind werd verspreid). De onderzoekers beschouwen het fossiel als een bij omdat het enkele voor deze diergroep karakteristieke kenmerken vertoont. Wellicht het belangrijkste hierbij is dat op alle ongeschonden onderdelen van kop, borststuk, achterlijf en poten vertakte, pluimachtige haren zitten. De pollen van bloemen die door bijen worden bezocht om daar de nectar uit te zuigen, hechten zich aan deze haren vast, en kunnen zo van bloem tot bloem worden verspreid, waardoor bevruchting van bloeiende planten plaatsvindt. Op de kop zitten twee antennes.Er zijn echter ook kenmerken die meer op die van een wesp lijken. Dat betreft onder meer de dunne achterpoten, maar wellicht nog opvallender is het ingesnoerde lijf: het is weliswaar geen echte wespentaille, maar het middendeel is duidelijk dunner dan bij bijen gebruikelijk is. Het samengaan van bijen- en wespenkarakteristieken wijst erop dat het gaat om een soort die evolutionair nog dicht staat bij de afscheiding van de bijen.

Sluit dit venster

Zorg voor de larven is een taak voor beginnende werksters. Maar hun carriere beginnen ze als schoonmaaksters. (Ryszard Maleszka)

Sluit dit venster

Broedzorg (Jeff Pettis, USDA-ARS Bee Research Lab)

Genetische kaart honingbij bekend//Gepubliceerd op vrijdag 27 oktober 2006/Planet Internet

En er is meer bijennieuws, veel meer. De honingbij speelt deze week de hoofdrol in de drie grote wetenschappelijke tijdschriften Nature, Science en Proceedings of the National Academy of Sciences. De genenkaart van dit sociale insect is namelijk af, en dat levert allerlei nieuwe inzichten op.

De honingbij, Apis mellifera, is pas het derde insect waarvan het DNA volledig gescreend is. Fruitvliegje Drosophila melanogaster en de mug Anopheles gambiae gingen hem voor. Die twee hebben lang niet zo’n ingewikkeld sociaal leven als de bij, en dat zie je terug in hun erfelijk materiaal. Zo heeft de bij veel meer genen die de reukzin bepalen, want geursignalen zijn belangrijk bij de communicatie in de bijenkorf. Smaakgenen heeft hij juist veel minder. Die zijn ook niet zo nodig, omdat hij doorgaans betrouwbaar voedsel voorgeschoteld krijgt van soortgenoten. Een vlieg of mug moet de hele tijd zelf uitzoeken wat er eetbaar is en wat niet.

Onderzoekers zijn vooral bijzonder ge챦nteresseerd in het bijenbrein. Een honingbij heeft grofweg een miljoen zenuwcellen, honderdduizend keer minder dan een mens. Toch kan hij verbazend veel. Zijn soortgenoten al dansend vertellen waar goed voedsel te vinden is bijvoorbeeld, en de locaties van een stuk of vijf goede voedselbronnen onthouden. Bijen kunnen zelfs menselijke portretten leren herkennen, toonden onderzoekers vorig jaar aan.

Amerikaanse en Belgische onderzoekers hebben zich verdiept in de signaaleiwitjes in de hersenen van bijen. Met de genenkaart in de hand vonden ze er tweehonderd, de meeste nog onbekend. Deze zogenoemde neuropeptiden sturen het gedrag. In een latere fase van het onderzoek moet blijken wat ze precies doen.

Dat verandert overigens sterk in de loop van een bijenleven, blijkt alvast uit het onderzoek van Gene Robinson en collega’s uit de VS en Frankrijk. Een werkster maakt namelijk carrière. Ze begint als larve, met eten en groeien als enige taken. Na de verpopping werkt ze binnenshuis als schoonmaakster, wordt na een paar dagen gepromoveerd tot nectarbewerkster, neemt dan de verzorging van larven op zich en gaat na twee weken meedraaien in de bewakingsdienst van de bijenkorf. Een week later begint het werk waar we bijen zo goed van kennen: van bloem tot bloem vliegen om nectar te verzamelen.

In elke levensfase wordt een eigen pakket genen afgelezen. Robinson en zijn medewerkers brachten dat in kaart en keken ook of de omstandigheden er invloed op hadden. Om genen op het spoor te komen die met sociaal gedrag te maken hebben, vergeleken ze de resultaten met die van bijensoorten die alleen leven. Ook hier moeten latere proeven uitwijzen wat elk gen precies doet.

Verder onthult de kaart van het bijen-DNA dat het aan-en uitzetten van genen op dezelfde manier gaat als bij gewervelde dieren. Die manier, het methyleren van DNA, gebruiken fruitvliegen en muggen niet. Waarom niet? Dat moet nog uitgezocht worden. Waarschijnlijk zijn ze het ergens in de loop van zeshonderd miljoen jaar evolutie kwijtgeraakt, want de gemeenschappelijke voorouder van bijen, muggen en mensen moet dit methyleringssysteem al gehad hebben.

Elmar Veerman

The Honeybee Genome Sequencing Consortium: ‘Insights into social insects from the genome of the honeybee Apis Mellifera’, Nature, 26 oktober 2006

Science, 28 oktober 2006: diverse artikelen.

Venijnig staartje  Biochemicus Nico Peiren meldt in het maandblad van de Universiteit Gent dat hij en zijn collega’s drie nieuwe componenten uit bijengif distilleerden,
waarvan minstens 챕챕n allergische reacties opwekt.
Interessant, want een vijfde van de mensen reageert allergisch op een bijensteek.
Gelukkig zijn de meeste bijen die mensen steken, werksters. Hun gif is minder zwaar dan dat van de bewakers van het nest.
31-05-2006
ZOEMENDE SPIONNEN

Bijen houden elkaar nauwgezet in de gaten om informatie te verzamelen over de aanwezigheid van nectarbronnen.
Het vakblad Current Biology meldt zelfs dat bijen exemplaren van andere kolonies in het oog kunnen houden om te kijken of die geen andere bloemen
bezoeken dan deze waaraan de speurneuzen zelf gewoon zijn.
En effectief! Af en toe leren ze iets uit dit soort contacten.
Een gevorderde vorm van sociaal leergedrag dus.
12-10-2005
BIJENBOL : BIJEN KOKEN WESPEN  Dat de natuur wreed kan zijn, is geen nieuws, maar het vakblad Naturwissenschaften beschrijft een wel heel drastische manier die bijen uitgedokterd hebben om grote roofwespen te elimineren.
Ze vormen een bol rond de aanvaller, waarin de temperatuur zo sterk stijgt dat het onfortuinlijke dier bijna begint te koken.
De methode heeft bijna altijd de dood van de wesp tot gevolg.
Knack – 09-11-2005
Slimme bijen  De hersenen van een bij zijn zo klein dat ze perfect op het topje van een lucifer passen, desondanks is hun werkzame geheugen bijna even efficiënt als dat van een duif of zelfs een aap.
Het werkzame geheugen past in het zogenaamde korte termijngeheugen.
Wij gebruiken het bijvoorbeeld om een telefoonnummer dat we net gelezen hebben in te toetsen.
Bijen kunnen, volgens de Proceedings of the National Academy of Sciences, iets vergelijkbaars – zo blijkt uit tests waarin ze getraind worden om bepaalde uitgangen uit het nest te gebruiken.
Bij de bijen zou dat kortetermijngeheugen ongeveer vijf seconden duren.
Dat is van dezelfde grootteorde als bij dieren die wij spontaan – maar onterecht – meer capaciteiten toedichten.
11-05-2005
Photo of honeybee brain. brein honingbij
Project Picture 1
Overview of the central honeybee (worker) brain labeled with phalloidin (green) and propidium iodide (red).
Project Picture 1
Pre-and postsynaptic labeling of microglomeruli (MG) in the lip using phalloidin (green) and anti-synapsin (red). Each MG (inset) comprises a presynaptic central bouton from antennal lobe PN terminals surrounded by KC dendritic spines.

Van de orchideeën en de  bijtjes

Een fossiel van een uitgestorven bij met wat orchideeënstuifmeel op zijn rug, helpt bij het bepalen van het uiterlijk en de stamboom van deze plant.

Goede staat
Het kostbare stuk amber dateert van 15 tot 20 miljoen jaar geleden. Het werd in 2000 gevonden in een mijn ten oosten van Santiago en bevat twee paketten met pollen van een orchidee in uitzonderlijk goede staat. De onderzoekers van de Harvarduniversiteit in Cambridge hebben de orchidee de naam Meliorchis Caribea gegeven en de bij geklasseerd onder de soortProplebeia dominicana.

Stamboom reconstrueren
“Het gaat om het eerste fossiel van een orchidee waarbij we, zoals nooit voorheen mogelijk was, de interactie tussen plant en pollen kunnen bestuderen”, luidt het. De evolutie van de orchideefamilie was tot nu toe erg onduidelijk. Dankzij deze ontdekking kon de fylogenetische stamboom van de orchidee gereconstrueerd worden:  De wetenschappers baseren  zich daarvoor op het DNA.

De orchidee챘nfamilie is een van de grootste plantenfamilies op aarde. Maar omdat ze allemaal dezelfde blaadjes hebben zijn er zo goed als geen betekenisvolle fossielen van deze bloemen voorhanden. Groot was dan ook de vreugde toen in 2000 een stukje barnsteen, oftewel gesteende hars, met daarin een bij met orchidee챘nstuifmeel op de rug ontdekt werd.Barbera Gravendeel van de Universiteit Leiden en haar collega’s gingen ermee aan de slag.

Blijkbaar haalden bijen toen ook al stuifmeel uit de bloemen. Bovendien moet het beestje met zijn hele lichaam in de bloemenkelk zijn gekropen om aan het stuifmeel te komen. Anders hadden de korrels wel op zijn kop gezeten en niet op zijn rug, redeneren Gravendeel en haar collega’s in het tijdschrift Nature.

Aan het stuifmeel is bovendien te zien waar de plant in de stamboom paste.

Het fossiel zelf is zo’n 15 tot 20 miljoen jaar oud, wisten de onderzoekers. Maar uit ingewikkelde stamboomberekeningen bleek dat de voorouder van de plant flink wat ouder was dan sommige wetenschappers dachten.

Hij zou uit het late Campanien stammen, zo’n 76 tot 84 miljoen jaar geleden

http://www.enews.ma/orchid-fossil_i66779_3.html

http://www.geneticarchaeology.com/Research/First_orchid_fossil_puts_showy_blooms_at_some_80_million_years_old.asp

“Since the time of Darwin, evolutionary biologists have been fascinated with orchids’ spectacular adaptations for insect pollination,” says lead author Santiago R. Ramiュrez, a researcher in Harvard’s Museum of Comparative Zoology and Department of Organismic and Evolutionary Biology. “But while orchids are the largest and most diverse plant family on Earth, they have been absent from the fossil record.”

The fossil record lacks evidence of orchids, RamÃirez says, because they bloom infrequently and are concentrated in tropical areas where heat and humidity prevent fossilization. Their pollen is dispersed only by animals, not wind, and disintegrates upon contact with the acid used to extract pollen from rocks.

This handout photo from Harvard University shows an amber-preserved stingless bee carrying pollinia of Meliorchis caribea, the first unambiguous fossil orchid known to science. The bee trapped by a glob of sap inside a come-hither orchid up to 20 million years ago has rewritten the evolutionary tale of a flower with the most fanatical following of any plant in the world.

De bij ‘Proplebeia dominicana’ in barnsteen.

Met stuifmeelkorrels van de orchidee ‘Meliorchis caribea’ op zijn rug. 
Wilde Flora  ( in Nederland )
zie ook :

Genetische blauwdruk buidelrat(opossum) ontcijferd

Wetenschappers hebben voor het eerst de genetische blauwdruk van een buideldier (   Marsupials     Buideldier      )   ontcijferd.

Deze mijlpaal in het dna-onderzoek werd bereikt door medewerkers van een wetenschappelijk instituut in Massachusetts, na drie jaar onderzoek van het erfelijk materiaal van een grijs Zuid-Amerikaans buidelratje met een zeer korte  staart,

Opossums  Monodelphis domestica. huisbuidelspitsmuis(  Gray Short-tailed Opossum )

Het buideldier wordt in Zuid-Amerika ook grijze colicorto en regenwoudrat genoemd. Het dier is een favoriet onderzoeksobject /model bij wetenschappers.

De ontcijfering van het dna van het dier kan van grote betekenis zijn voor onderzoek naar de ontwikkeling van de mens en voor de geneeskunde. De onderzoeksresultaten zijn woensdag  9 mei 2007 verschenen in de tijdschriften Nature en Genome Research.

Buideldieren en mensen zouden 180 miljoen jaar geleden dezelfde voorouders hebben gehad. De colicorto heeft wat de samenstelling van zijn genoom veel gemeen met de mens. Een van zijn bijzonderheden, waar medische wetenschappers profijt voor de mens uit hopen te halen, is dat pasgeboren colicorto’s die hun ruggengraatje breken, erin slagen weer geheel te genezen.

short-tailed%20possum%20200.jpg

http://blogs.discovermagazine.com/loom/2007/05/09/did-grandma-have-a-pouch-and-other-thoughts-on-the-opossums-genome/

Monodelphis domestica.
http://www.the-scientist.com/news/home/53187/

http://scienceblogs.com/loom/2007/05/09/did_grandma_have_a_pouch_and_o.php

Opossum , Junk DNA  en  evolutionaire innovaties
Het ontcijferen  van genoom van een kleine opossum heeft veel  meer  duidelijkheid gebracht over  het proces  waarbij de evolutie , nieuwe schepselen dmv  oudere recepten construeert  , en waarbij werd aantgetoond  dat de
veranderingen  hoofdzakelijk  gebeuren  door nieuwe manieren te vinden om bestaande  genen aan en uit te zetten …
Het is in feite het begin  van  een  grote (internationale ) herziening van onze kennis  over de genetische evolutie  ( hier  begonnen door een  internationaal consortium geleid door het Broad Institute van MIT/harvard .
De wetenschappers dachten vroeger eerder  dat evolutie  voornamelijk  langzaam ( en gradueelgebeurde   omdat de  genen  zelf   muteerden  die tot specifieke nieuwere  proteïnen ( genprodukten van de “veranderde ” genen  )leiden.
Aangezien de proteïnen(=  enzymen )  veranderden  , veranderderde  dat  ook de schepselen die er uit resulteerden  en  er drager van zijn .Het huidige onderzoek toont aan dat de opossum en de menselijke eiwit-coderende genen,  weinig zijn veranderd of van elkaar  vervreemd sinds de split tussen beiden 180 mj gelden …
Het zijn de wisselende patronen  van de  aan  en uitgezette  genen ,  die  dramatische veranderingen  in het  uiteindelijk  resulterende  morfogenetische  en  fysiologisch chemisch   fenotype op gang brengen  .
De “evolutie pruts meer met  de  controles  dan aan de genen zelf,”  zei
Directeur Eric Lander  vh  “Broad Institute  MIT / Harvard
“Bijna  elke   nieuwe evolutionaire  (uit)vinding … komt voort uit de regelgevende controle dragers en  mechanismen
In feite, hebben de buidelzoogdieren en placentale zoogdieren grotendeels de zelfde reeks van eiwit-coderende  genen.
Maar  20 % van de regulerende ingeschakelde/uitgeschakelde  instructie-patronen ,  en  aanwezig in het menselijke genoom , is uitgevonden nadat wij en de buideldieren  uit elkaar gingen  “
Het vrijgegeven onderzoek, (Woensdag 9 Mei 2007 ) illustreerde ook een mechanisme voor die regelgevende veranderingen.
Het toonde aan dat een belangrijke bron van genetische innovatie  voortkomt uit  mobiele DNA-elementen :  Transposons   die  ruwweg de helft van ons genoom uitmaken en die vroeger  werden afgedaan als  waardeloos   JUNK DNA
 Het onderzoek toont aan dat deze zogenaamde junk niet allemaalomhet even wat is maar dat het veeleer ook elementen bevat die de evolutie  aandrijven  door zich tussen chromosomen rond te springen en  genen aan en uit  te schakelen op/in nieuwe   schakel-opstellingen . “
Tijdens  het onderzoek  werd een buideldier-genoom ontijferd  :  dat van het grijs gekleurde, kleine in de handpalm passend opossum, een inwoner van Zuidamerikaanse regenwouden
De buideldieren, die kangoeroes en koalas omvatten, hebben jongen  die de hoofdmoot van hun  embryonale – ontwikkeling doorlopen in een  buidel  buiten het lichaam van de moeder in plaats van in  een inwendige  schoot zoals bij mensen en  andere “placentale zoogdieren.”
Lander zei
dat dit werk was dat het nieuwe belang van de regularisaties  van eiwit-coderende  genen  midden in de  evolutietheorie  plaatste.”

Men had aanvankelijk gedacht dat het grootste deel van werkende  genoom van een schepsel uit eiwit-coderende  genen was samengesteld  en dat een vrij klein gedeelte van  het  DNA uit sturende gedeelten bestond die de rest  vertellen
wanneer  aan of uit moet worden geschakeld .

Verdere  vooruitgang in de studies van zoogdiergenomen  maakte  duidelijk
dat die opvatting  onjuist was. Het regulerend  deel van het genoom was twee tot drie keer groter dan het gedeelte dat eigenlijk de instructies voor individuele proteïnen bewaard . Het tot dan toe heersende “offici챘le leerboek” over  het genenwerk “scheen niet juist te zijn  ” zei  Lander.
“Er was veel meer in  het genoom dat zich bezig hield met het
geven van  instructies aan de eigenlijk eiwit producerend genen zelf  “
Dat stelde de vraag naar “ hoe de evolutie-mechnanismen   eigenlijk aan het genoom werken ” zei Lander nog .
Met zo veel van het genoom bestemd voor de regelgeving en sturing   werd het duidelijk dat de evolutie alleen  kon werken  door de instructeurs ( of zelfs de instructies )  zelf  eenvoudig te veranderen eerder dan het muteren  van de
eiwit-coderende  genen .
Het opossumgenoom verstrekte een belangrijk vergelijkings-punt  omdat het verder  afstaat van   de  mens dan gelijk welk ander placentaal  zoogdieren van wie het  genoomen reeds  was   bestudeerd.
Terwijl de gemeenschappelijke voorvader van mensen en de opossums 180 miljoen jaar geleden uiteengingen , splitsen  de gemeenschappelijke voorvader van mens en de muis slechts  80 miljoen jaar geleden.
De opossums zijn belangrijke modellen voor menselijke ziektestudies omdat zij het enige dier buiten mensen zijn die
melanoma – huidkanker – na blootstelling aan ultraviolette straling ontwikkelen.
en
(zoals reeds  in het  openingbericht vermeld )
Zij worden ook gebruikt in zenuwstelselonderzoek omdat de babyopossums hun ruggemergweefsel kunnen regenereren nadat het werd doorgesneden  en  daardoor de capaciteit herwinnen om hun lidmaten te bewegen.

The first marsupial to have its genome sequenced,                                          
the laboratory opossum is a valuable model
ScienceDaily (10 Mei..2007) –
°
*zee-egel  …
Some Strongylocentrotus purpuratus embryo pics





photos by AJP `99

Last update: May 5th 2000 by Albert J. Poustka

Homo floresiensis

AFSTAMMING VAN DE MENS en de mensachtige
°
UPDATE ; 
2013
800px-lb1_skull

Homo floresiensis, the three-foot “hobbit” human whose remains were discovered on the Indonesian island of Flores in 2003, has now been designated as a real species truly distinct from H. sapiens.

This species lived fairly recently—38,000-12,000 years ago, when modern humans were already colonizing the New World—but is very distinct from H. sapiens

Because of its size and the resemblance of the skull to those seen in certain human diseases (hypothyroidism, microcephaly, etc.), some scientists speculated that this was not a tiny archaic species living at the same time as modern humans, but simply a single pathological individual of H. sapiens.

A new analysis by Baab et al.  suggest however, that this really was a tiny hominin species.  Extensive morphological analysis of the single existing skull from Flores, along with modern H. sapiens, both “normal” and suffering from a variety of syndromes suggested to have produced the Flores skull, as well as a variety of early hominin species, shows that the Flores skull is more similar to that of H. erectus than to nearly all pathological specimens, and is thus likely to truly represent a new species.

(See the New York Times report by John Noble Wilford.)


Researchers found that the cranium of Homo floresiensis, known as hobbits, top, was more similar to skulls of various human predecessors than to modern Homo sapiens, bottom.

” ….Our analyses corroborate the previously suggested link between LB1 and fossil Homo and support the attribution of this specimen to a distinct taxon, H. floresiensis. Furthermore, the neurocranial shape of H. floresiensis closely resembles that of H. erectus s.l. and particularly specimens of early Eurasian H. erectus, although it is unclear whether this latter affinity is best attributed to a close phylogenetic relationship or to a size-related convergence in shape.

These results also counter the hypotheses of pathological conditions as the underlying cause of the LB1 neurocranial phenotype, with the possible exception of posterior deformational plagiocephaly, a condition without significant adverse health effects/….” 

Baab, K. L., K. P. McNulty, and K. Harvati. 2013. Homo floresiensis Contextualized: A Geometric Morphometric Comparative Analysis of Fossil and Pathological Human Samples. PLoS ONE 8:e69119 EP  -.

°
°
    File:Homo floresiensis.jpg    
°

floresfrontfloresrightfronthomo-floresiensis

Flores

A long-lost cousin has been discovered, Homo floresiensis, or Flores Man. It’s especially dramatic for a number of reasons. It’s relatively recent, with the youngest specimen only 18,000 years old, but it is most closely related to Homo erectus. This species was also minute, only 3 feet tall, and tiny-brained. Here we have a group of small, specialized human relatives, living contemporaneously with Homo sapiens, on isolated islands in Indonesia. It’s like discovering that Munchkins were real  http://pandasthumb.org/pt-archives/000582.html Flo /LB 1

flores-man-skullThis   grapefruit-size Homo floresiensis skull is apparently from a 30-year-old female who lived 18,000 years ago on Flores, an island in Indonesia. The small brain suggests that the new human species is not a pygmy Homo sapiens but rather a descendant of Homo erectus. ref. Photograph :  Peter Brown/Nature     http://www.nature.com/news/specials/flores/index.html °

floresiensis

L’HISTOIRE  SE  RéPèTE   :  Verhaal van  een Déjà Vu  ° In 2003 reageerde de wetenschappelijke wereld verbijsterd op de vondst van een nieuwe, kleine mensensoort, Homo floresiensis, gevonden in Laat–Pleistocene lagen in de grot Liang Bua op het Indonesische eiland Flores. Nu, bijna 10 jaar na de ontdekking, is nog lang niet iedereen ervan overtuigd dat het hier om een nieuwe mensensoort gaat. En dat is ook niet geheel verwonderlijk, want deze tijdgenoot van onze eigen soort zet veel ideëen over menselijke evolutie op losse schroeven. Met een geschatte herseninhoud van 400 cc en een lichaamslengte van hooguit 106 cm lijkt Homo floresiensis recht in te druisen tegen de theorie dat zowel lichaamslengte als hersengrootte gedurende de menselijke evolutie toenamen.

°

Veel critici zijn op basis van deze kenmerken van mening dat H. floresiensis niets meer en niets minder is dan een populatie moderne mensen, al dan niet lijdend aan een of meerdere aandoeningen. De aandoening in kwestie varieert van microcephalie (ontwikkelingsstoornis resulterend in kleine hersenen) en cretinisme (een gebrek aan jodium) tot diverse vormen van dwerggroei (groeistoornis), waaronder het syndroom van Laron (een ongevoeligheid voor groeihormoon).

°

Inmiddels zijn een groot aantal van deze claims weerlegd. 

°

Moderne mensen arriveerden pas rond 4.000 jaar geleden op Flores (Homo floresiensis stierf rond 17.000 jaar geleden uit), en dit sluit uit dat H. floresiensis stiekem een moderne mens zou zijn .

Bovendien duidt de aanwezigheid van meerdere individuen over een periode van minstens 50.000 jaar erop dat deze populatie van zogenaamd zwaar pathologische mensen zich aardig wist te redden in een niet al te vriendelijke natuurlijke omgeving.

Deze maand is er nog zo’n claim weerlegd.

In een nieuw artikel in the Journal of Human Evolution heeft Peter Brown korte metten gemaakt met de hypothese dat Homo floresiensis een populatie modern mensen met cretinisme zou kunnen zijn, een idee van de hand van de Australische wetenschapper Peter Obendorf. 

Volgens Obendorf en de zijnen zijn de kleine lichaamslengte en het kleine brein van H. floresiensis kenmerkende gevolgen van een tekort aan jodium op Flores. 

Aan de hand van een puntsgewijze analyse van medische literatuur over cretinisme wijst Brown deze hypothese van de hand.

Een gebrek aan jodium komt voor onder de bevolking in het binnenland van Flores, maar er is in de medische literatuur geen enkel geval bekend waarbij dat leidde tot een kleine lichaamslengte. Daarnaast laat de medische literatuur zien dat patienten met cretinisme een brein van normale afmetingen hebben, in tegenstelling tot wat Obendorf beweert.

Obendorf haalt ook andere kenmerken van de schedel van Homo floresiensis aan, zoals een ongefuseerde fontanel en verhoogde asymmetrie, die op cretinisme zouden moeten wijzen.

Brown, die zelf onderdeel uitmaakte van het opgravingteam in 2003, claimt echter dat de schedel enigszins verdrukt uit de grond kwam en tijdens het opgraven beschadigd raakte. Volgens Brown richten Obendorf en collega’s zich op een klein aantal kenmerken van H. floresiensis die toevallig ook bij cretins voorkomen.

Het enige kenmerk dat H. floresiensis wél deelt met cretins is een draaiing in de humerus, een van de botten uit de arm, maar dat komt ook voor bij Homo erectus uit Dmanisi (Georgië).

Het debat over de status en beschrijving van Homo floresiensis is dus verre van bekoeld.

Paleo-anthropologen hopen vurig op nieuwe vondsten uit Liang Bua die het debat een nieuwe wending kunnen geven.

°

Maar het stekken van nieuwe takken in de menselijke stamboom gaat lang niet altijd over rozen.

°

Toen in 1856 de eerste resten van Neanderthalers ontdekt werden in het Duitse Neanderdal, waren velen ervan overtuigd dat het hier om een oude Hollander van Marken of Urk of een verdwaalde Mongoolse Kozak ging.  

°

Ook Eugène Dubois, de Nederlandse paleontoloog die op Java de resten van Pithecanthropus erectus (nu Homo erectus) vond, werd bij terugkomst in het geciviliseerde Europa ontvangen met twijfel, hoongelach en soms zelfs ridicule.

°

De geschiedenis herhaalt zich, keer op keer. Het zal nog minstens een generatie duren voordat ook het stof over Homo floresiensis weer is neergedwarreld.

°

Brown, P. (2012). LB1 and LB6 Homo floresiensis are not modern human (Homo sapiens) cretins. Journal of Human Evolution 62, 201-224

Archaeologist Thomas Sutikna examines the Homo floresiensis skeleton that he and his team excavated from Flores in 2003

Archaeologist Thomas Sutikna examines the skeleton of Homo floresiensis that he and his team discovered on the island of Flores in 2003. What other “Lost Worlds” remain to be found in Wallacea?

4311043a-f1_2
     flores2

Floresmens stamt af van kleine voorganger Homo erectus

 9 januari 2010 Hendrik Spiering

http://www.nrc.nl/wetenschap/article2454779.ece/Floresmens_stamt_af_van_kleine_voorganger_Homo_erectus

 

Een nieuwe reconstructie van de Floresmens. Illustratie S. Pailly & E. Daynès / JHE
 °
De kleine Floresmens, die tot 15.000 jaar geleden nog leefde op het Indonesische eiland Flores, is hoogstwaarschijnlijk géén verdwergde Homo erectus.
°
De Floresmens stamt af van een lid van het geslacht Homo dat vóór Homo erectus leefde en zelf ook al vrij klein was. Deze gewijzigde afstamming van de Floresmens is de kern van een artikel van de vinder van de fossielen, Michael Morwood. Hij schreef het concluderende artikel in een special van het Journal of Human Evolution (november), geheel gewijd aan de Floresmens.
°
Zoogdiersoorten die zonder veel natuurlijke vijanden op een eiland leven worden vaak kleiner.
°
Toen vijf jaar geleden de mysterieuze Floresfossielen werden gevonden, was dat dan ook de eerste verklaring van de geringe lengte (slechts één meter) van deze mensachtige, met zijn verrassend kleine herseninhoud van 417cc.
°
De vroege Homo’s, waarvan nog altijd niet veel fossielen bekend zijn, waren echter zelf ook niet al te groot (ca. 130 cm) en hun herseninhoud evenmin (ca 600 cc).
°
Het geslacht Homo ontstond ongeveer 2,5 miljoen jaar geleden in Afrika. 
°
Erectus, die vanaf 1,8 miljoen jaar rondliep, was lang: wel 180 cm. De vroege-homo-maar-niet- erectus-afstammingstheorie schemerde al door in eerdere anatomische analyses van de Homo floresiensis, waarin veel primitieve pre-erectus-kenmerken werden gevonden.
°
Ook de nieuwere onderzoeken die nu zijn gepubliceerd tonen dat de kleine Floresmens duidelijk behoort tot het geslacht Homo, maar in allerlei anatomische details toch nog wel heel primitieve kenmerken had, die bij H. erectus al waren verdwenen. Echt Homo is bijvoorbeeld de dikte van de Floresschedel, de hoogte van het gezicht en de vorm van het kuitbeen.
°
Maar sommige kenmerken van de kaak lijken toch nog wel op die van de voorganger van Homo, de nog chimpansee-achtige Australopithecus.
°
De korte onderbenen, het ontbreken van de boog in de voet, de polsbeentjes, enzovoorts: overal duiken primitieve kenmerken op.
°
Als deze nieuwe afstammingstheorie klopt, zouden dus al voor H. erectus mensachtigen Afrika hebben verlaten, iets waarvoor tot nu toe geen duidelijke bewijs is gevonden. Maar de Nederlandse archeoloog Wil Roebroeks betoogde al jaren geleden (Nature, 22 december 2005) dat zo’n vroege expansie waarschijnlijk is en zelfs dat H. erectus buiten Afrika kan zijn ontstaan, uit deze vroege emigranten

°

 

UPDATE

Was the ‘Hobbit’ species the result of island shrinkage?

°

http://www.bbc.co.uk/news/science-environment-22169189 BBC News. 17 April 2013

The origin of the hobbit inforgraphic
hypothesis  1: Some critics say that the hobbit isn’t a separate species at all, but belonged to a group of modern humans whose size was restricted because they had a disease. Sommige wetenschappers (behorend tot deze groep ) geloven echter niet dat het brein van de mensensoort homo erectus  zo sterk kon krimpen. Zij vermoeden dat Floresmensen moderne mensen waren die leden aan een ziekte waardoor ze niet goed groeiden.
Hypothesis  2: Others believe that it evolved from a tiny-brained, ape-like creature that travelled from Africa millions of years ago. het is volgens die wetenschappers  mogelijk dat de dwergachtige mensen zijn ontstaan uit een kleine, aapachtige voorouders .
Hypothesis  3: But the new research suggests that an early human species that lived in Asia called ” Homo erectus”  arrived on the island and underwent dwarfism.

17 april 2013

http://www.nu.nl/wetenschap/3399955/floresmens-had-gekrompen-brein.html

 

Het brein van de zogenoemde Homo floresiensis had een gemiddeld volume van ongeveer 426 kubieke centimeter. Daarmee waren de hersenen van de dwergachtige mensensoort iets groter dan tot nu toe werd aangenomen. De bevinding wijst er op dat de Floresmens een dwergversie was van de primitieve mensensoort Homo erectus.   Dat schrijven onderzoekers van het Nationaal Museum van Natuur en Wetenschap in Tokio in het wetenschappelijk tijdschrift Proceedings of the Royal Society B.

°

Nog altijd is het onduidelijk hoe Floresmensen zijn geëvolueerd. Uit de in 2003 ontdekte fossielen van de 18.000 jaar oude mensensoort blijkt dat ze slechts een meter lang waren. Volgens een reeds eerder gestelde populaire theorie zijn de ‘hobbits’ ontstaan uit een relatief grote voorouder in Oost-Azië, de Homo erectus. Toen deze primitieve mensen naar het eiland Flores verhuisde zouden ze in de loop der generaties zijn gekrompen.

°

Een dergelijk evolutionair proces staat bekend als eilanddwerggroei.

°

Nieuwe metingen van de Japanse wetenschappers wijzen er op dat het brein van Floresmensen groter was dan tot nu toe werd aangenomen. Dat maakt eilanddwerggroei volgens hen waarschijnlijker. Hoofdonderzoeker Yousuke Kaifu denkt dat de dwergmensen afstammen van een relatief kleine versie van de Homo erectus, die op het eiland Java leefde. Het brein van deze mensensoort had een volume van ongeveer 860 kubieke centimeter.

°

Het is volgens Kaifu niet onmogelijk dat een brein door eilanddwerggroei krimpt van 860 naar 426 kubieke centimeter. “Met ons werk kan ik niet bewijzen dat de Homo erectus de voorouder van de Homo floresiensis is, maar we hebben wel aangetoond dat het mogelijk is”, verklaart de wetenschapper

Door: NU.nl/Dennis Rijnvis

Een nieuwe reconstructie van Homo floresiensis

24 augustus 2009  Mieke Roth
°
Het begon met  het reconstrueren van Homo floresiensis naar aanleiding van een aanname die Gert van den Bergh had geopperd. Van den Bergh is een Nederlandse paleontoloog die op het eiland Flores, de vindplaats van Homo floresiensis, voornamelijk bezig was met de verdere aanwezige paleontologische fauna: mini-olifanten en reuzenratten. De link hierboven verwijst naar het persbericht dat er naar aanleiding van de publicatie is gemaakt.
°
Het maken van die reconstructie was een hels karwei. Niet zo zeer om de reconstructie zelf als wel de hoeveelheid tijd die ik had: twee weken. Ik heb er toen dag en nacht aan gewerkt met als resultaat een niet bijzonder mooie plaat, maar wel eentje die liet zien waar het om ging.
°
Het idee wat Van den Bergh opperde was zo controversieel dat er vanuit zijn collega’s voornamelijk afkeurend op werd gereageerd. Het verhaal is echter, met mijn reconstructies, wel de hele wereld over geweest.
°
Eerder was al een reconstructie gemaakt door Peter Schouten voor National Geographic en dat is tegenwoordig de meest bekende reconstructie van Homo floresiensis.
Hobbit-Like Human Picture Gallery: Photo of floresiensis and sapien skulls   01-hub-little
Deze reconstructie laat in feite een (klein) mens zien met het hoofd (een beetje) aangepast aan de gevonden schedel. Het is een reconstructie die tot de verbeelding spreekt, maar het is ook al een tijdje duidelijk dat hij niet correct is. Nu is het maken van een reconstructie zonder de fysieke botten erg moeilijk. In 2005 moest ik de reconstructie maken aan de hand van foto’s die ik van Van den Bergh kreeg en het interview dat ik met hem had. Dat was veel meer dan dat er toen nog verder in de openbaarheid te vinden was, maar nog steeds erg moeilijk.
°
Opvallend is wel dat mijn reconstructie en eentje die in 3d werd gemaakt door Elisabeth Daynes aan de hand van de schedel van LB1, wel redelijk op elkaar lijken. Dat zit hem voornamelijk in de schedel.
daynes reconstruction
Met de reconstructie van de rest van het lijf ben ik het niet eens, maar ook dat is natuurlijk een kwestie van interpretatie.
°
Ook heeft Daynes haar reconstructie een menselijke neus gegeven, terwijl de LB1 schedel een dusdanige vorm heeft dat er van een uitstekende neus met een neusbrug zoals wij hem hebben, geen sprake was. Dan is de reconstructie van Schouten realistischer (qua neus dan, de hoogte van het schedeldak is duidelijk te groot).
°
Beide reconstructies laten een heel erg petit lijf zien met kleine handen en voeten.
°
Ondertussen zijn we vier jaar verder en er is een hoop onderzoek gedaan naar de vondsten uit de grot op Flores.
°
Je kunt wel zeggen dat er een oorlog is gevoerd over de vraag of Homo floresiensis een ziekelijke variant van Homo sapiens was of dat het met recht een soort genoemd mag worden.
°
Tegenwoordig is het overgrote deel van de betrokken wetenschappers het er over eens dat Homo floresiensis niet alleen een echte soort was, maar naar alle waarschijnlijkheid veel verder van de huidige mens af staat dan dat men eerder aannam.
°
 bipedality in  Homo floresiensis
floresiensis  flo  in situ LB1
    homo-floresiensis_aanpassing-tenen
 Nieuwe reconstructie Homo floresiensis.  
°
Het blijkt namelijk dat Homo floresiensis op een aantal punten veel primitiever is dan dat we in eerste instantie dachten. Zo primitief dat Homo floresiensis eerder een directe afstammeling lijkt vanAustralopithecus afarensis (Lucy), dan van Homo erectus, wat eerder werd verondersteld. Die opvallende kenmerken zitten voornamelijk in de ledematen.
°
De handwortelbeentjes lijken bijvoorbeeld veel meer op die van mensapen en Australopithecus afarensis dan op die van de mens. En dit is een belangrijk kenmerk. Mensenhanden zijn bij uitstek geschikt om gereedschappen mee te maken, onze duim kan zich heel makkelijk ten opzichte van de andere vingers bewegen en de basis van onze hand is relatief breed waardoor de vingers met een grote precisie kunnen worden gebruikt. Hoewel mensapen best wel veel met hun handen kunnen, ook gereedschappen maken bijvoorbeeld, zit er vooral daar een duidelijk verschil. Dat is ook van de buitenkant te zien: mensen handen zijn relatief korter en breder met een lange duim. Het tweede opvallende kenmerk zit hem in Homo floresiensis‘ voeten. Die blijken, wat een toeval, heel erg groot te zijn. De lengte van de voeten is 70% die van het bot van het dijbeen, daar moet je bij mensen niet om komen. Homo floresiensis kan dus met recht Hobbit worden genoemd! Overigens is de grote teen opvallend kort en hebben de rest van de tenen een duidelijk afwijkende vorm. Het laatste opvallende kenmerk is de schouderpartij.
°
De draaiing van de bovenkant van het bot van de bovenarm was overigens de aanleiding voor de stelling van Van den Bergh: die was zoveel kleiner dan bij de moderne mens, dat het onwaarschijnlijk leek dat Homo floresiensis net zoveel bewegingsmogelijkheden met zijn armen had als dat wij dat hebben.
°
Over de tijd is er nog veel meer bekend geworden over de schouderpartij. Zo blijkt dat ook de schouderbladen en de sleutelbeenderen een totaal andere vorm hebben dan dat wij gewend zijn. Met als gevolg dat de schouders veel ronder waren dan bij ons, waardoor je het gevoel kreeg naar een veel gespierdere schouderpartij te kijken.
°
De schouderbladen bevonden zich veel meer aan de zijkant van de ribbenkas in plaats, zoals bij ons, op de rug. Al met al vind ik het daarom nog steeds niet raar dat Van den Bergh met zijn stelling kwam.
°
Afgaand echter op de heupbeenderen van Homo floresiensis, die heel duidelijk laten zien dat hij in ieder geval rechtop kon lopen (maar dat kon Australopithecus afarensis ook al), zal dat echter niet zijn normale doen zijn geweest.
MODEL5_plus 1..1
 Schouderpartijen. A. Homo erectus. B. Homo floresiensis. C. Homo sapiens
°
Nog even terugkomend op de meest voorkomende manier om Homo floresiensis af te beelden: als een heel fragiel wezen.
°
De botten spreken dat tegen. Homo floresiensis was duidelijk robuust gebouwd voor zijn lengte, met een brede ribbenkas en ronde vormen. Naar alle waarschijnlijkheid had hij een duidelijke grote buik, de darmen moeten ergens heen en leek de spieropbouw meer op die van mensapen dan op die van de mens.
°
Als je naar chimpansees kijkt zie je dat ze bijvoorbeeld forse dijbeenspieren hebben, maar vrijwel geen kuiten. Doordat Homo floresiensis wel erg grote voeten had zullen die kuitspieren er wel geweest zijn, maar dus ook die dijbeenspieren.
°
In ieder geval, dit zijn mijn overwegingen geweest om een nieuwe reconstructie te maken van Homo floresiensis. Nu die reconstructie af is, zie ik dat er nog een aantal dingen zijn die ik zou willen verbeteren: zo staan de ogen bijvoorbeeld te ver uit elkaar en zijn de wangen misschien niet rond genoeg en ik denk dat ik de armen iets dichter tegen het lijf moet maken, maar aan de hand van de onderzoeken van de laatste jaren is dit grofweg waar ik op uitkom.
°
En het ziet er al een stuk beter uit dan die eerste keer! Zoals alles in de paleontologie, is dit een beredeneerde schatting. Ik zeg dus niet dat ik gelijk heb, maar dat dit is zoals ik het nu zie. En naar alle waarschijnlijkheid kijk ik er over weer vier jaar heel anders tegenaan, maar dat is het leuke van het vak.
 °

Het begin

°

De ontdekking van deze  menselijke skeletten op het Indonesische eiland Flores is de spectaculairste vondst van de afgelopen vijftig jaar op het gebied van de paleoantropologie, de wetenschap die het ontstaan van de mens bestudeert.

°

Bijzonder is dat de ‘Homo floresiensis’ zoals de nieuwe soort wordt genoemd, tot minimaal 13.000 jaar geleden nog rondliep, een tijd waarin ook de moderne mens (Homo sapiens) al tijden bestond. °

Mogelijk hebben beide soorten zelfs naast elkaar geleefd.

°

Zeven individuen …..In totaal hebben de ontdekkers skeletresten gevonden van zeven individuen van de Homo floresiensis.

°

Als eerste troffen de Australische onderzoekers een deel van een vrouwelijk skelet( “Flo” )  aan in een kalkstenen grot, waarvan er velen op Fores bestaan. In eerste instantie dachten de wetenschappers dat het om restanten van een kind ging, maar na bestudering van de schedel en het gebit, bleek dat het om een volwassen vrouw ging van een geheel nieuwe soort. De vrouw woog naar schatting 25 kg, was één meter lang en was vlak voor haar dood circa dertig jaar. Ze stierf zo’n 18.000 jaar geleden.

°

Na de vondst van de vrouw werden later resten van nog eens zes individuen ontdekt.

°

Intelligentie

°

Aan de hand van de vondsten concluderen de onderzoekers dat de Homo floresiensis gemiddeld niet langer werd dan één meter en dat de schedelomvang vergelijkbaar is met een pompelmoes De herseninhoud bedroeg gemiddeld zo’n 380 cc, vergelijkbaar met die van een chimpansee.

°

Die geringe inhoud zegt volgens de onderzoekers echter niets over de mate van intelligentie. 

°

Zo staat vast dat deze kleine mensen vuur konden maken, stenen werktuigen gebruikten en dat ze bepaalde jachttechnieken moesten hanteren om onder meer op dwergolifanten en reusachtige hagedissen te kunnen jagen, die destijds op Flores voorkwamen.

°

Naast elkaar

°

Uit analyse van de skeletresten blijkt dat de jongste resten 13.000 jaar oud zijn en de oudste 95.000 jaar. Dat betekent dat de Homo floresiensis en de moderne mens, Homo sapiens, zo’n 30 tot 40.000 jaar naast elkaar hebben geleefd in Zuid-Oost-Azië.

°

Of dat echter ook op het eiland Flores is gebeurd, is niet bekend. De dwergmensen op Flores stierven vermoedelijk zo’n 12.000 jaar geleden plotsklaps uit door een zware vulkaanuitbarsting op het eiland, al zijn er geruchten dat ze nog veel langer hebben doorgeleefd.

°

Volgens legendes van de huidige inwoners van Flores leefden er vroeger dwergmensen die bekend staan als ‘Ebu Gogo’. Deze harige dwergen van één meter lang zouden nog hebben bestaan in de tijd dat de eerste Nederlandse handelsreizigers in de zestiende eeuw op Flores arriveerden.

°

Klein

°

Paleoantropologen denken dat de dwergmensen op Flores vele tienduizenden jaren een geïsoleerd bestaan hebben geleid en dat ze daardoor zo klein van stuk waren. “Wanneer soorten in isolatie leven kunnen ze in verschillende richtingen evolueren. Sommige worden groot andere juist klein,”aldus Henry Gee van het tijdschrift Nature waarin het nieuws over de nieuwe mensensoort naar buiten is gebracht.

°

De dwergmensen op Flores werden vermoedelijk steeds kleiner door het schaarse voedselaanbod. Vanwege hun geringe omvang worden de dwergen van Flores door sommige onderzoekers wel ‘Hobbits’ genoemd, naar de kleine mensachtige wezens in de films van Lord of the Rings.

°

 TENTOONSTELLING-DE MENS4 miljoen jaar  mens / Homo erectus ontfermt zich over een gewonde man.
°
Flores-mens stamt af van homo erectus?
     floresiensis  flo head construction
40830752-hobbit-bbc-203
  

http://news.bbc.co.uk/2/hi/science/nature/4331252.stm
floresiensis  head reconstruction 1

hobbit face
The path Hayes took to reach her facial approximation.

°

Reconstruction: The Hobbit was only 1m tall and possessed “primitive” features

°

Isolement  …….De Flores-mens stamt volgens de onderzoekers af van de homo erectus. De homo erectus wordt beschouwd als de voorloper van de moderne mens, de homo sapiens. De erectus verspreidde zich twee miljoen jaar geleden over Afrika en Azie en stierf vermoedelijk een half miljoen jaar geleden uit. De homo erectus, van wie de Flores-mens afstamt, was  even lang als de moderne mens.

°

Maar er bestaan diverse voorbeelden van zoogdieren die krimpen bij de afwezigheid van natuurlijke vijanden. Volgens de onderzoekers is dit ook bij de Flores-mens het geval.

°

Een grote vulkaanuitbarsting maakte twaalfduizend jaar geleden vermoedelijk een einde aan het bestaan van de Flores-mens.

°

DNA Vanwege de geringe ouderdom zijn de gevonden skeletten nog niet volledig gefossiliseerd. Daardoor hopen wetenschappers nog DNA uit de resten te kunnen traceren. Dat is bij Europese Neanderthalers van ongeveer dezelfde ouderdom ook gelukt.

°

DNA-onderzoek zou geheel nieuwe inzichten kunnen opleveren over de evolutie van de mensachtigen en hoe die zich over de wereld hebben verspreid.

°

De Australische onderzoekers, verbonden aan de universiteit van New England, zetten hun onderzoek voort op andere eilanden van Indonesië in de hoop nog meer nieuwe soorten dwergmensen te ontdekken.

°

Bronnen: NatureReutersBBC

°Links: Special: Flores Man (Nature) “Hobbit” Discovered (National Geographic) 2004 Neos.nl / Planet Internet en http://www.elsevier.nl/nieuws/wetenschap/artikel/asp/artnr/5656/index.html 2006 : 

°

“NIKS  ‘VERDWERGDE ‘  ERECTUS   ”  , zeiden tegenstanders.

°

Die ‘hobbit van de Australische onderzoeker Mike Morwood en de zijnen is niets anders dan een soort pygmee, een dwergvorm van de moderne mens.

°

Deze dwerg leed aan microcephalie, een ziekte waarbij de hersenen zich minimaal ontwikkelen. Die ziekte komt ook tegenwoordig nog voor.

°

En de vroege mens leefde niet geïsoleerd op Flores, een voorwaarde voor verdwerging.

°

2007

°

Maar het Morwood-team sloeg diverse keren terug.  Bijvoorbeeld, in februari 2007  ook in PNAS, beschreef het een vergelijking tussen de schedel van de H. floresiensis en schedels van negen lijders aan microcephalie en tien gezonde mensen.

°

Conclusie: de Floresmens leek in sommige opzichten op moderne mensen, maar andere kenmerken duiden op H. erectus en zelfs op Australopithecus, de aapmens-voorgangers van de Homo-soorten Tot nu toe lijkt dit alles op een keurig wetenschappelijk debat. 

 

°

Maar er is meer aan de hand.

°

De indonesqche paleoantropoloog  (Tekeu ) Jacob bemoeilijkte vanaf het begin het werk van Morwood en de zijnen. Tegen hun zin nam hij de H. floresiensis-fossielen mee naar zijn hoofdkwartier in Jogjakarta om ze pas veel later (– beschadigd –) terug te geven.

°

Morwood maakte hij uit voor  een soort  ‘hobbit’…… En Indonesië sloot op zijn aanstoken   de verdere  toegang tot de fameuze grot, af  .(zie hieronder  –>Het TekeuJacobs  schandaal) Indonesië  geeft de grot  echter  weer vrij voor onderzoek, in 2007  . Dat is van groot belang, want er resten nog vele vragen over de hobbit van Flores. ° Zo’n vraag is bijvoorbeeld hoe de vroege mens het eiland heeft bereikt en of hij misschien al verdwergd was toen dat gebeurde. En de hamvraag natuurlijk: is de gevonden hobbit verdwergde regel of zieke uitzondering? Er is immers maar één schedel gevonden en weinig andere beenderen.

°

Nader veldwerk lijkt dus geen luxe. Flores-hobbit krijgt misschien gezelschap (VOLKSKRANT )

°

Hobbit geen mismaakt mens   Februari  2007

°

Het 18 duizend jaar oude skelet van een mini mensje, opgegraven op het Indonesische eiland Flores, behoort  toe aan een nieuwe soort mens die nauw verwant is aan de Homo Sapiens. °

Sommige wetenschappers dachten dat het skelet die in 2003 is gevonden toebehoorde aan een pygmee of een mens met een abnormaal kleine schedel (microcephalic). Microcefalie is een afwijking van het centrale zenuwstelsel waarbij de schedelomvang te klein is. Het is meestal een aangeboren aandoening waardoor de hersenen zich niet goed ontwikkelen en klein blijven. Wetenschappers van de Florida State University concludeerde echter iets anders.

°

Aan de hand van een driedimensionale computer reconstructie kan afgeleid worden dat de hersenen misschien klein zij maar verder overeenkomt met die van normale mensen.

°

Volgens paleontologist Dean Falk betreft het hier geëvolueerde hersenen die optimaal gebruik maakt van de beperkte ruimte van de schedel.

°

Homo floresiensis (vernoemd naar de vindplaats Flores) was ongeveer 1 meter lang en veroorzaakte hevige discussies onder antropologen. Voorheen werd aangenomen dat na het uitsterven van de Neanderthaler (Homo Neanderthalensis) de Homo Sapiens de enige overgebleven mens was. De homo floresiensis, die tot 18.000 jaar geleden op het Indonesische eiland Flores rondliep, was nauwelijks één meter groot. Zijn hoofd was niet veel omvangrijker dan een volgroeide pompelmoes.

°

Een internationaal onderzoeksteam ontdekte nu dat zijn hersenstructuur sterke gelijkenissen vertoonde met die van de rechtop lopende homo erectus of op die van een minstens even sterk ontwikkelde australopithecus. De knaap had echter slechts eenderde van de hersenmassa van de moderne mens.

°

Dean Falk, paleoneuroloog aan de universiteit van Florida, bracht enkele kenmerken van de fossielen in verbinding met onze voorouder, de homo sapiens.

°Het shuine voorhoofd  bijvoorbeeld. ,

,Het feit dat hij ongetwijfeld de zee moet zijn overgestoken om zich op het eiland Flores te vestigen en de vondst van afgevijlde werktuigen en sporen van een zelfgemaakt vuur in de buurt van de fossielresten wijzen erop dat hij echt niet van de domste was”, stelt Falk. ,,Een driedimensionaal model van de structuur van de hersenen toont een duidelijke zwelling van de voorste hersenkwabben. Nog tal van andere anatomische bijzonderheden hebben er ons van overtuigd dat hij sterke waarnemingskwaliteiten bezat.”  Volgens Falk zijn er twee conclusies mogelijk. ,,Ofwel is de homo floresiensis nauw verwant met de homo erectus en kromp hij tot een dwerg uit voedselschaarste op het eiland, ofwel was er een tot nu toe onbekende voorvader van de homo erectus en de homo floresiensis die kleiner van lichaams- en hersenbouw uitviel.”

Dean Falk  http://www.cosmosmagazine.com/node/999 http://noorderlicht.vpro.nl/artikelen/28459170/


WIJ WAREN NIET ALLEEN

Door Dirk Draulans ( knack 10 october 2004 )

°

De ontdekking van een minimensensoort die tot 12.000 jaar geleden geleefd zou hebben, doet opnieuw de vraag rijzen naar hoe wij met andere mensensoorten omgingen. Want het is nog altijd niet duidelijk wat onze rol was bij de verdwijning van de neanderthaler. Het moeten vreemde momenten geweest zijn. Eerst het besef dat de piepkleine mensenschedel die je in je handen houdt, niet van een kind afkomstig kan zijn, omdat de schedelnaden dichtgegroeid zijn, en de tanden slijtagesporen vertonen – typisch voor volwassen schedels.

°

En vervolgens de wetenschap dat de schedel amper 18.000 jaar oud was. Dat is het nabije verleden, toen wij verondersteld werden al eventjes de enige mensensoort op aarde te zijn. Na de ontdekking van Homo floresiensis op het Indonesische eiland Flores, en de beschrijving ervan in het wetenschappelijke topvakblad Nature, zal ons inzicht in onszelf nooit meer hetzelfde zijn.

°

Het was al langer duidelijk dat de moderne mens (Homo sapiens) niet het resultaat was van een lineaire evolutie naar steeds complexere kenmerken die ons bewustzijn en zelfs zelfbewustzijn schonken – en de daaraan gekoppelde idee-fixe dat we iets uitzonderlijks zijn. Het inzicht groeit dat wij slechts een van de vele mensensoorten uitmaken, die ooit op de aarde rondscharrelden.

°

De deskundigen zijn er nog lang niet uit, maar momenteel circuleren er namen voor minstens veertien mensensoorten, en nog eens minstens zes onmiddellijke menselijke voorouders. Er moeten prehistorische tijden geweest zijn dat er meerdere mensensoorten tegelijk op aarde rondliepen, die misschien zelfs nauw contact met elkaar hadden, zoals nu in het tropische regenwoud, waar apen van verwante soorten samen optrekken in grote groepen.

°

De minimensjes van Flores illustreren daarenboven dat de mens  nog altijd onderhevig was aan dezelfde evolutionaire mechanismen als de andere dieren. De wezentjes waren amper een meter groot met een gewicht van maximaal twintig kilogram – dat is vergelijkbaar met een kind van onze soort van drie jaar oud. Maar het waren geen dwergen, in de strikte betekenis van het woord, want die hebben verhoudingsgewijs alleen heel korte armpjes en beentjes, terwijl de nieuw ontdekte soort normaal geproportioneerdwas.

Het waren ook geen pygmeeën, want de herseninhoud van pygmeeen is vergelijkbaar met de onze, terwijl die van Homo floresiensis amper een kwart daarvan bedroeg.

°

Er wordt verondersteld dat de soort rechtstreeks van een andere mens afstamt, de Homo erectushoewel hij moderne trekken vertoont, zoals de totale afwezigheid van een uitstekende ‘snuit’ – de kleine australopitheken, die drie tot vijf miljoen jaar geleden aan de basis van de mensvorming stonden, hadden wel zo’n snuit.

°

Draken en mini-olifanten

°

De hobbits van Flores, zoals ze al gemeenzaam genoemd worden, zijn waarschijnlijk het gevolg van een evolutionaire aanpassing aan het leven op kleine eilanden, en, meer nog, op eilanden bedekt met tropisch regenwoud. Want daar zijn zo weinig calorieën te rapen dat individuen die kleiner zijn, méér overlevingskansen hebben dan andere. Wat klein blijven dus in de hand werkt.

°

De evolutie naar dwerggroei kan trouwens enorm snel gaan, ze kan zich in amper enkele duizenden jaren voltrekken.

°

De mensjes voedden zich onder meer met mini-olifanten, even groot als een pony, maar toch nog tot een ton zwaar, die eveneens van veel grotere soorten afstamden. Ze moesten wel voorzichtig blijven voor  komodovaranen, echte draken, wat zou kunnen verklaren waarom ze verhoudingsgewijs iets langere armen hebben dan wij: zo konden ze gemakkelijker in de bomen vluchten als ze op zo’n beest botsten.

°

Er zijn ook aanwijzingen gevonden dat onze nieuwe familieleden hun voedsel kookten, dat ze samenwerkten bij de jacht en vrij gesofisticeerde werktuigen maakten, weliswaar aangepast aan hun beperkte lichaamsomvang, wat allemaal impliceert dat ze een gevorderde vorm van intelligentie hadden.

°

Er wordt zelfs verondersteld dat ze honderdduizenden jaren geleden met een soort boten op het eiland arriveerden. Dat zadelt de vorsers met een nieuw raadsel op. Als hun kleine herseninhoud hen er niet van weerhield om min of meer dezelfde creativiteit aan de dag te leggen als tijdsgenoten met grotere hersenen, moet het concept van de evolutie van intelligentie misschien bijgestuurd worden.

°

Het inzicht groeit namelijk dat intellect niet gekoppeld is aan het volume van de hersenen, maar aan de dichtheid van het netwerk van verbindingen die hersencellen met elkaar maken.

°

Er zouden dus al veel langer dan algemeen wordt aangenomen slimmeriken op aarde rondgelopen kunnen hebben. De vraag rijst ook wat er uiteindelijk met de mensjes is gebeurd. Het meest voor de hand liggende antwoord is dat ze zo’n 12.000 jaar geleden samen met onder meer de mini-olifanten weggevaagd werden door een enorme vulkaanuitbarsting. Maar bizar is dat er onder de huidige bevolking van het eiland een legende circuleert over de Ebu Gogo (letterlijk: ‘de grootmoeders die alles aten’), een stam piepkleine mensen waarvan de beschrijving akelig gedetailleerd is en bijna perfect overeenstemt met de fossiele vondsten van vorig jaar.

°

Die kabouters zouden tot ongeveer honderd jaar geleden geleefd hebben. Er worden nu expedities op het getouw gezet om in de laatste restanten van het regenwoud op Flores, en in grotten allerhande, naar sporen van die mythe te zoeken.

°

Een haar zou volstaan om er DNA uit te puren, en definitieve besluiten te kunnen trekken over de nieuwe mensensoort. De kans dat er DNA uit de slecht bewaarde fossielen gehaald kan worden, is voorlopig klein.

°

Maar als het waar is dat deze hobbits tot vrij recent overleefden, dan zijn wij pas nu als mens alleen op de wereld. Dan zijn wij nooit uniek geweest, hebben wij de aarde altijd met verwanten gedeeld. Wat de vraag doet rijzen hoe wij ons, als grote slimmeriken, ten opzichte van onze naaste verwanten gedroegen.

°

Als de manier waarop wij nu over andere rassen spreken, of waarop wij tot voor kort met exemplaren van andere rassen zeulden als curiosa, kan worden geëxtrapoleerd naar een andere mensensoort, moeten wij ons misschien al bij voorbaat meewarig op de borst slaan en mea culpaclaimen.

°

Zeker op eilanden hebben ontdekkingsreizigers en andere zwervers al menig diersoort de vernieling ingejaagd. Wat er zou gebeuren, mochten wetenschappers op een afgelegen Indonesisch eiland enkele overblijvers vinden van de kleine Homo floresiensis of een andere mensensoort. Zouden wij het respect kunnen opbrengen om die mensen in hun waardigheid te laten? Of zouden we ze, zoals zo dikwijls is gebeurd, naar onze hand willen zetten, ze willen ‘beschaven’, of als een toeristische attractie exploiteren? Gezond verstand is niet per definitie zaligmakend.

°

http://en.wikipedia.org/wiki/Homo_floresiensis

°

religie ?

°

Desmond Morris http://news.bbc.co.uk/1/hi/magazine/3964579.stm —-> De X-factor bestaat niet 

NEANDERTHALER

Succesvolle kruisingen  ?

In kringen van antropologen en paleontologen woedt al een tijdje een heftig debat over de vraag wat er precies met de neanderthaler is gebeurd. Het is ondertussen, op basis van DNA-onderzoek, vrijwel zeker dat hij geen voorloper van ons was, en ook geen andere ondersoort van de moderne mens, maar een volwaardige soort: Homo neanderthalensis.

°

Die ontstond ongeveer 150.000 jaar geleden, en leefde tot 30.000 jaar geleden in dikwijls moeilijke omstandigheden (de ijstijden) in Europa en het Midden-Oosten, waar hij ongeveer 20.000 jaar lang de aanwezigheid van de moderne mens moest dulden. Hoewel de populatiedruk toen eindeloos veel kleiner was dan vandaag, want er waren toen nog lang niet zoveel mensen. Desalniettemin blijft de vraag waarom de neanderthaler zo plotseling van het toneel verdween. Het is  snel duidelijk dat de algemene visie over het contact tussen beide mensensoorten in twee groepen uit elkaar valtl. Zij die ervan uitgaan dat er geen enkel genetisch contact was tussen neanderthaler en moderne mens, wat impliceert dat de neanderthaler om een of andere reden gewoon verdween.

°

En zij die aannemen dat de neanderthaler min of meer opging in de moderne mens, door succesvolle kruisingen, zodat wij zijn genetisch materiaal nog altijd gedeeltelijk meeslepen. Een tweede vraag is of neanderthalers intellectueel inferieur waren aan de moderne mens. En of ze bijgevolg in moeilijke omstandigheden rechtstreeks of onrechtstreeks door de nieuwkomers weggeconcurreerd kunnen zijn.

°

In vele kringen overheerst nog altijd de mening dat neanderthalers domme bruten waren, die op geen enkele manier konden wedijveren met de technisch verfijnde moderne mens, hoewel hun schedelinhoud lichtjes groter was dan de onze.

°

Dat wij als moderne mens systematisch neanderthalers zouden hebben achtervolgd om ze de kop in te slaan, wordt door bijna niemand voor realistisch gehouden. Hoewel, de Britse paleontoloog Ian Tattersall merkte  terecht op dat ‘een periode van tienduizend jaar ruimschoots kan volstaan voor een genocide op een kleine, verspreide populatie van een aparte mensensoort’.

°

De fysieke verschillen tussen de neanderthaler en de eerste moderne Europeanen (de Cro-Magnons) zouden zo groot zijn geweest dat iedereen ze meteen zal hebben gezien. Tattersall gaat er ook van uit dat de neanderthaler de laatste overlever was van een aantal mensensoorten die nog vroeger in Europa ontstaan waren.

°

Europa zou zo’n miljoen jaar geleden gekoloniseerd zijn geweest door de Homo erectus: een soort die ongeveer 1,8 miljoen jaar geleden in Afrika ontstond en later uitzwierf over de oude wereld. Maar omdat de mensen toen slechts in kleine gemeenschappen leefden, die zich regelmatig aanpasten aan lokale klimatologische en andere omstandigheden, die rondstruinden in territoria met een straal van maximaal 80 kilometer, en die soms door landschappelijke barri챔res geen enkel contact hadden met elkaar, zou er regelmatig een soort ‘adaptieve radiatie’ zijn opgetreden: een aanpassing aan specifieke omstandigheden die tot de vorming van een nieuwe soort kon leiden. Tattersall is een voorstander van de stelling dat er waarschijnlijk veel meer mensensoorten zijn geweest dan wij bereid zijn aan te nemen – hij zal ongetwijfeld verheugd zijn met de ontdekking van de hobbits op Flores. ‘Er zijn verschillende manieren om mens te zijn’, stelde hij tijdens zijn tussenkomsten. ‘Diversiteit speelt op vele plaatsen in het dierenrijk een cruciale rol. Toch blijft de neanderthaler in de hoofden van velen nog altijd niet passen in ons concept van menszijn.’

°

Parels van tanden

°

Het is duidelijk dat de neanderthaler al werktuigen en andere gebruiksvoorwerpen (zoals kledij) maakte voor hij in contact kwam met de moderne mens. De vraag blijft echter in welke mate hij primitiever was dan de moderne mens, en eventueel dingen van hem afkeek. Misschien was hij in staat om onafhankelijk innovaties door te voeren. Een kwestie die  tot verhitte discussies leidde, en die de Franse paleontoloog Jean-Jacques Hublin deed uitroepen:

We hebben de neanderthaler lang onterecht als een domme bruut beschouwd, maar nu vinden sommigen blijkbaar dat we hem helemaal moeten rehabiliteren, dat we hem zoveel mogelijk op onszelf moeten laten lijken, wat misschien wel politiek correct is, maar in ieder geval niet gesteund wordt door onze wetenschappelijke bevindingen. En wat is er in godsnaam mis met niet helemaal een moderne mens te zijn?’

°

Zelfs in discussies over onze voorouders zijn verwijten van racisme nooit ver weg. Hublins landgenoot Francesco D’Errico is de voornaamste verdediger van de hypothese dat de neanderthaler, onafhankelijk van de moderne mens, een eigen cultuur ontwikkelde, dat beide soorten elkaars culturele equivalenten waren:

‘De neanderthaler bewerkte dierenhuiden voor hij met de moderne mens in contact kwam, hoewel hij daarbij misschien geen echte naalden hanteerde. Net als moderne mensen maakten neanderthalers kralen, maar zij gebruikten daarvoor vooral tanden waar ze een gaatje in boorden, terwijl moderne mensen eerder stukjes been en schelp gebruikten. Verschillende methodes dus.’

D’Errico somde nog een aantal vaststellingen op om de overtuiging onderuit te halen dat wij, moderne mensen, de eersten waren om een vorm van cultuur te ontwikkelen.

°

Zo zijn er méér graven van neanderthalers gevonden dan van prehistorische moderne mensen.

‘In ons modern zijn kunnen we mijns inziens een deel van de erfenis van de neanderthaler terugvinden’,

besloot D’Errico zijn controversieele, maar met veel gegevens gelardeerde visie.

°

De Brit Paul Mellars stelde vast dat werktuigen in Europa sneller evolueerden dan in Afrika, en vroeg zich af waarom dat zo geweest zou zijn:  

‘Het is misschien toeval, maar de snelste culturele explosie vond zo’n 35.000 tot 40.000 jaar geleden plaats, op het hoogtepunt van het contact tussen neanderthalers en moderne mensen. Het was ook de tijd van de opkomst van het symbolisme in de cultuur, wat ik als een vorm van communicatie interpreteer. Ik denk dus dat de neanderthaler over een primitieve taal beschikte, hoewel we daar weinig tot niets over weten.’

Mellars analyseerde ook klimaatgegevens uit het Europa van die tijd, en kwam tot de vaststelling dat het toen lange tijd zo koud was dat de neanderthalers ongetwijfeld zuidwaarts waren gemigreerd, waardoor de contacten met de uit het oosten gekomen moderne mensen frequenter werden.

°

‘Misschien versterkten die frequente contacten de noodzaak om een eigen identiteit te creëren, wat de ontwikkeling van symboliek zou kunnen verklaren. We weten overigens uit historische gegevens over de eerste contacten tussen blanken en indianen in Noord-Amerika dat de uitwisseling in twee richtingen gebeurde. Waarom zou dat dan in de prehistorie niet het geval zijn geweest?’

Een tijdmachine

°

Het klimaat speelt steeds meer een sleutelrol in verklaringen over de verdwijning van de neanderthalers. Geoloog Frans Gullentops van de Katholieke Universiteit Leuven gaf in Tongeren enkele voorbeelden van het uitzicht van het Vlaamse landschap in de prehistorie, zoals de Maas die meer dan een kilometer breed was en in een alluviale vlakte afgeboord met zandduinen vloeide, of de Dijle die in sommige periodes over een ijslaag van meer dan 15 meter dik vloeide, hoewel Vlaanderen nooit een permafrost, een permanente ijsbedekking, kende. In de zomer was er altijd genoeg zon om de bovenlaag te ontdooien en in een dikke modderlaag te veranderen.

°

Thijs van Kolfschoten van de Universiteit Leiden bestudeert de prehistorische fauna in onze streken. In alle onderzochte families verdwenen er regelmatig soorten, of werden soorten vervangen door andere. Dat gebeurde in families zo divers als vliegende eekhoorns, woelmuizen, tapirs, mammoeten en neushoornen. Er waren ooit zelfs nijlpaarden in Europa.  

°

‘Niet alleen nu is er een grote druk op het milieu’, stelde van Kolfschoten. ‘Uit onze gegevens blijkt dat ijstijden aanleiding geven tot een veel snellere evolutie van soorten dan meer gematigde omstandigheden.’

°

Impliciet bracht van Kolfschoten de boodschap:

°

als vele andere dieren zoveel veranderingen ondergingen, waarom zou dat dan niet voor mensen het geval zijn geweest?

°

De neanderthaler ontstond waarschijnlijk in uitgestrekte bosgebieden, maar zou zich toch goed aan harde leefomstandigheden hebben aangepast, want zelfs in de ijsperiodes kwamen er neanderthalers voor tot tegen de Baltische Zee.

‘De neanderthaler floreerde vooral op steppes, waar een ongelooflijk groot aantal dieren leefde’, aldus van Kolfschoten.

°

De Britse wereldexpert inzake de neanderthaler Chris Stringer vatte zijn visie over de verdwijning van de soort als volgt samen:

‘Ik ben van mening dat de neanderthaler gewoon pech heeft gehad. Net op het ogenblik dat de contacten met de moderne mens intensifieerden, bereikten de ijstijden een hoogtepunt. Dat leidde tot een verhoogde competitie in de weinige toevluchtsoorden waar beide soorten samengedreven werden. Als de moderne mens er toen niet was geweest, had de neanderthaler dat misschien overleefd. Of als het toen niet zo koud was geweest, hadden wij nu misschien nog altijd de aarde met hem gedeeld.

°
07/05/09 Een aparte soort / Mei 2009 Eos-magazine
°
Twee studies, van voetbeentjes van de ‘hobbit’
°
°
en van oude dwergnijlpaarden in Madagaskar,
°
tonen aan dat de Floresmens geen ‘zieke’ Homo sapiens was.
°
Er lijkt stilaan een einde te komen aan het wetenschappelijke debat over de plaats die de Floresmens toekomt in de stamboom van de mens.
°
De bewijzen stapelen zich (lichtjes) op dat de acht skeletten die in 2003 in de Liang Bua-grot op het Indonesische eiland Flores werden gevonden, wel degelijk tot een aparte mensensoort moeten worden gerekend: Homo floresiensis, die tot 18.000 jaar geleden – en misschien tot veel later – op het eiland leefde.
°
In Nature staan twee nieuwe artikels waarin wordt aangetoond dat het om een vroege afsplitsing gaat van Homo erectus, en dat de dwerggestalte een gevolg is van de evolutie op het eiland.
°
Antropologen uit het andere kamp geloven dat de Floresmens (door zijn dwerggroei ook wel ‘hobbit’ genoemd) een zieke variant was van de moderne mens Homo sapiens. De hobbits zouden geleden hebben aan microcefalie, maar konden wel stenen gereedschap maken (dit werd ook gevonden op Flores).
°
Een Amerikaans team paleoantropologen van Stony Brook University in New York onderzocht enkele voetbeentjes van een van de acht skeletten. De voet van de hobbit leek in één opzicht heel menselijk: een grote teen parallel aan de andere tenen en gewrichten die de tenen doet uitrekken wanneer alle gewicht op de voeten komt te rusten.
°
Maar de voet lijkt ook op die van een aap: een ‘grote’ teen die eigenlijk heel is en de andere tenen lang en gekromd. Omdat het onwaarschijnlijk is dat de Floresmens na zich af te splitsen van de moderne mens primitiever is geworden, moet hij zich dus veel vroeger hebben afgesplitst, waarschijnlijk van Homo erectus.
°
Britse wetenschappers van het Natural History Museum in Londen deden onderzoek naar oude nijlpaardfossielen in Madagaskar: niet direct iets wat je in verband zou brengen met de Floresmens. Maar ze vergeleken de fossielen grondig met vondsten van op het Afrikaanse vasteland (van voorouders van de Madagaskische nijlpaarden).
°
De uitgestorven dwergnijlpaarden op het eiland bezaten veel kleinere hersenen dan hun verre voorouders op het vasteland, waarschijnlijk het resultaat van op een – weliswaar groot – eiland te leven. Diersoorten evolueren doorgaans naar kleinere afmetingen wanneer ze op een geïsoleerd eiland terechtkomen.
°
(sst) Groot en klein “We weten dat dieren zowel in reuzen- als in mini-uitvoering kunnen voorkomen.
°
Klein
°
Henry Ghee : “Dwergherten en ook minimammoeten hebben bestaan, dus een dwergmens behoorde ook tot de mogelijkheden. Alleen werd er nog nooit een bewijs van zijn bestaan gevonden, hij leefde alleen in legenden en sprookjes. Maar nu het skelet van de homo floresiensis is gevonden, een harige mens die een meter groot is, lijkt het me waarschijnlijk dat we nog andere skeletten van dwergmensen zullen terugvinden over de hele wereld.
Ze zijn waarschijnlijk uitgestorven, maar er blijft een kans bestaan dat ze nog ergens rondlopen op aarde. We ontdekken nog steeds nieuwe soorten grote zoogdieren. Ik schat de kans dat we een levende mini mens vinden niet kleiner dan de kans op de ontdekking van een nieuw soort antilope, en dat is al gebeurd.” De kleine harige dwergmens kreeg meteen ‘de hobbit’ als bijnaam.
Hoe kleiner het dier, hoe groter de kans dat het een pels heeft en behaard is. Een olifant heeft geen pels, een konijn wel. Dat heeft alles te maken met warmteregeling. Een klein dier verliest meer warmte dan het kan opwekken.
Dus heeft het een pels, veren of een behaard lichaam nodig om zijn warmte vast te houden.
°
Grotere dieren zijn beter in staat om warmte op te wekken, hun probleem is dan weer de overtollige warmte kwijt te raken. Ze hebben meer binnenkant dan buitenkant, en daarom is het moeilijker om de overtollige warmte kwijt te spelen. Een pels kunnen ze missen als kiespijn. Een olifant heeft dan ook helemaal geen pels, maar twee heel grote huidflappen als oren, zodat er toch meer buitenkant is om zijn grote binnenkant te helpen afkoelen.”
Dwergvormen komen vooral voor op eilanden.
“Hoe groter een dier is, hoe groter het territorium dat het nodig heeft om zich te kunnen voeden. Als een dier op een eiland terechtkomt, waar er dus maar een beperkte ruimte beschikbaar is, is het beter om naar een kleiner formaat te evolueren.
Als het kleiner is, vindt het makkelijker eten, heeft het minder ruimte nodig en kan het met meer soortgenoten op minder oppervlakte samenleven. (zie ook Updates onderaan)
Er zijn zoveel voorbeelden van dieren die op eilanden tot een dwergvorm evolueren. Er is het dwerghert dat op de Kanaaleilanden leefde, de miniolifant die vroeger op het eiland Malta rondzwierf en vroeger kwam er ook een mammoet zo klein als een pony voor op Wrangeleiland.
Het is dus geen toeval dat de dwergmens op het Indonesische eiland Flores is ontdekt.
“Klein zijn heeft dus voordelen, maar het nadeel is dat kleinere dieren minder lang leven. Ze hebben een snellere stofwisseling en gaan dus sneller dood. Ter compensatie planten ze zich ook sneller voort en hebben ze meer nakomelingen.”
Dieren met uitwendig skelet zijn echter altijd klein
°
De grootste spin ter wereld is de vogeletende Goliathspin uit Zuid-Amerika. Als je haar poten erbij neemt, is ze zo groot als het bord waaruit je eet. Haar lijf is echter niet groter dan een briefje van 50 euro.
°
Een spin die twee dwergen kan verpletteren onder haar gewicht, kan niet bestaan. Het probleem is dat een spin geen skelet heeft. Het harde materiaal waar bij zoogdieren, vogels en reptielen de botten van gemaakt zijn, zit bij spinnen aan de buitenkant. Ze hebben geen sterke botten en een kwetsbare huid, maar een hard pantser van chitin dat een kwetsbare massa aan de binnenkant beschermt. De enige manier om groter te worden voor spinnen is hun pantser afwerpen, zichzelf groter maken en dan een nieuw pantser laten groeien. Het probleem is dat ze zonder schild bijzonder kwetsbaar zijn en hun eigen gewicht niet eens zouden kunnen dragen. Vandaar dat reuzenspinnen niet kunnen bestaan.
°
NOTA
 °
Natuurlijk bestonden er vroeger “reuzeninsecten “ dat heeft dan weer te maken met de zuurstofrijke atmosfeer —> Insekten ademen door tracheeen —> dat zijn porien die in het lichaam de zuurstof inbrengen door eenvoudige verbinding met de buitenwereld … Wanneer de lichamen te groot zouden worden kan de benodigde zuurstof niet meer zo gemakkelijk alle delen van het lichaam bereiken … het is het zuurstof-gehalte van hun omgeving die hun grote beperkt …
°
Reuzengroei
°
Dus alleen zoogdieren en reptielen kunnen reuzen worden?
“Reptielen zijn de echte reuzen. De dinosaurussen zijn de grootste dieren die op aarde hebben rondgelopen, ze wogen tot 80 ton.
Dat reptielen het grootst kunnen worden is te danken aan hun botten, die lichter zijn dan die van zoogdieren.
Daardoor waren ze in staat ondanks hun omvang toch actief en snel te blijven. Een tweede voordeel van de dino’s was dat ze eieren legden en dus niet zoals zoogdieren grote en zware embryo’s met zich mee moesten dragen.

UPDATE

°

http://www.nu.nl/wetenschap/1960401/hobbit-blijkt-aparte-soort.html http://www.nhm.ac.uk/                                http://commcgi.cc.stonybrook.edu/am2/publish/Research_20/ SBU_Study_of_Hobbit_Skull_New_Evidence_Fossil_Was_A_Species_Other_Than_Human_printer.shtml

http://miv10.informatics.sunysb.edu/body.cfm?id=2474 http://commcgi.cc.stonybrook.edu/am2/publish/General_University_News_2/Stony_Brook_University_Displays_FirstEver_Cast_Of_Hobbit_At_7th_Annual_Human_Evolution_Symposium.shtml

http://commcgi.cc.stonybrook.edu/am2/publish/Medical_Center_Health_Care_4/ The_Hobbit_Foot_Like_No_Other_In_Human_Fossil_Record_SBU_Researchers_Detail_Its_Ape_And_Human-Like_Features.shtml

°

*Het feit dat het brein van de hobbit zo klein is, zegt niet zo veel over zijn intellectuele vermogens, maar meer over efficiëncy en aanpassing aan een kleiner lichaamsvolume. De hobbit heeft qua intelligentie ws niet ondergedaan voor homo erectus. * Het is op een eiland (en uitgaande van een grote soort als stamvader/ en zeker bij zoogdieren ) voordelig om dwerggroei te ontwikkelen . =men dient minder voedsel te bemachtigen Vooral grote hersenen zijn een energieverslinder *natuurlijk is er een limiet aan het verkleinen : immers , wordt het(zoog) dier te klein dan kan het moeilijk zijn lichaamswarmte behouden wat dan weer moet worden opgelost door meer voedsel te verorberen …

°

Uiteraard veroorlooft een tropische omgeving een verschuiving van die limiet naar beneden …. ( bv spitmuizen moeten tot 3X hun lichaamsgewicht/per etmaal , verorberen om in leven te blijven )

°

* dieren afstammend van kleine soorten ( bijvoorbeeld muizen en ratten ) zullen op eilanden groter worden ( ook ) omdat ze dan minder moeten eten dan hun kleinere voorouders ; Dat is zeker het geval wanneer er geen specifieke predatoren aanwezig zijn….De grotere exemplaren zullen bovendien beter kunnen concuren om voedsel met hun kleinere soortgenoten,terwijl ze er minder van nodig zullen hebben

°

*alles draait dus rond de optimale lichaamsgrote bij – een schaars voedselaanbod – het heersende klimaat – De aan(af)wezigheid van predatoren tengevolgen van de geografische isolatie Reuzengroei is trouwens een normaal verschijnsel bij koud klimaat—>poolstreken

°

Het kleinste (land) zoogdier, de http://nl.wikipedia.org/wiki/Wimperspitsmuis , is trouwens niet aanwezig in NW europa en de poolstreken Hoe noordelijker hoe groter de soorten worden

°

David Keys WETENSCHAPPERS ONTDEKKEN UITZONDERLIJK BEWIJS VAN ‘UITGESTORVEN’ NEVEN VAN HOMO SAPIENS

Homo floresiensis alongside Homo sapiens. The new species of human’s adult size was about that of a three-year-old modern-human child. The skull of H. floresienses was the size of a grapefruit
hsapiensfront
hsapiensrightPhotograph courtesy Peter Brown/Nature
This grapefruit-size Homo floresiensis skull is apparently from a 30-year-old female who lived 18,000 years ago on Flores, an island in Indonesia. The small brain suggests that the new human species is not a pygmy Homo sapiens but rather a descendant of Homo erectus. Photograph courtesy Peter Brown/Nature
Homo erectus skull

°

Het pas ontdekte beendermateriaal van Flores, werd gepubliceerd in het wetenschappelijk tijdschrift Nature, en zou ( werd ook eerst verondersteld ) afkomstig kunnen zijn van een soort die zich 3 miljoen jaar geleden afsplitste van de (?) Australopithecus (onze verre voorouder) of, waarschijnlijker, van een soort die afstamt van een vroege vorm van een latere voorouder, de Homo erectus.

“De vondst van het beendermateriaal is een grote verrassing omdat hominiden met die lichaamslengte en herseninhoud 3 miljoen jaar geleden uitgestorven zouden zijn”,

zegt Peter Brown, fysisch antropoloog aan de universiteit van New England en medewerker van de opgraving.

°

ONTDEKKING en aankondiging eerste VERSLAG

°

In september 2003 ontdekten Australische en Indonesische onderzoekers de resten van een tot nu toe onbekende mensensoort in een kalkgrot (Liang Bua grot )op het Indonesische eiland Flores. Ruim een jaar later, eind oktober 2004 publiceerden zij hun onderzoek in het Amerikaanse tijdschrift Nature

°De ontdekking ;

°

http://news.nationalgeographic.com/news/2004/10/1027_041027_homo_floresiensis.html http://www.sciencedaily.com/releases/2004/10/041028144857.htm

°

Little People  of  Flores
°

The remains of three-foot-tall humans are discovered on a remote Indonesian island. Compare the Brains

Compare the Brains

Contrast the shape and size of a Homo floresiensis brain with a chimp’s and a modern human’s. Jared Diamond Interview

Jared Diamond Interview

The evolutionary biologist explains why the little people shrunk, how they got to Flores, and more. Ask the Expert

Ask the Expert

Bert Roberts of Australia’s University of Wollongong answers your questions about Homo floresiensis and his experience as part of the team that discovered its remains.

See the 11-minute broadcast segment.  Watch the SegmentDamaged
°
°

°

Het Tekeu Jacobs schandaal

°
Deel I van de Hobbit controverse
Ondertussen is er grote beroering rond deze vondsten onstaan = vooral door het ingrijpen van de Indonische paleantropoloog Tekeu Jacobs , die heeft voorgesteld dat de homo floresensies alleen maar een ” dwergras is van homo sapiens “
°
Overigens krijgt Tekeu jacobs steun van de aanhangers van
de multi-regionale theorie die stelt dat de homo sapiens multiregionaal verschillende keren uit homo erectus is onstaan en niet is geevolueerd uit de afrikaanse erectus zoals de out of africa 2 theorie stelt …
°
Het is echter veel kwalijker dat Jacobs zich de fossiellen heeft toege-eigend … Hij heeft ondertussen wel beloofd dat hij ze terug zal vrijgeven , maar dat is dus nog altijd niet gebeurt ….
 °
De oervervelende menselijke( en soms schurk-achtige ) kantjes van sommige opportunistische wetenschappertjes
°
Teuku Jacobs , blijkt een al even venijnig soort mens en intrigant als wijlen Richard Owens die indertijd de ontdekker van de Dino’s , in de grond stampte en vervolgens de verdere “eer” voor zichzelf behield ….Dat is niets nieuw ; Bovendien ook sommige kernfysici verkopen wel eens “atoomtechnologie ” om een grijpstuiver te bemachtigen of om hun ” land ” te dienen ..
.
°
O, nee. Het belangrijkste mensenfossiel van de laatste tientallen jaren is in handen gekomen van het grootste enfant terrible van de paleoantropologie. De 73-jarige Indonesiër Teuku Jacob van de Universiteit van Gadjah Mada staat erom bekend dat hij nooit fossielen afstaat voor onderzoek.
°
Bovendien is Jacob een felle nationalist met een bloedhekel aan Amerikanen en onderzoekers die niet ‘geïnteresseerd zijn in onze jonge natie’, zoals hij eens zei tegen het blad Science
°
( Noot ;
“De enige nieuwe dwergen zijn die australiers ” zei teuku aan de telefoon … Ook de indonesische archeologen die met de australiers meewerkten kregen een veeg uit de pan —>” die doen het alleen maar om subsidies los te krijgen .” )
En nu heeft Jacob de fossiele botten opgeëist van de ‘floresmens’, een één meter hoge dwerg die achttienduizend jaar geleden moet hebben geleefd in Indonesië.
°
( Noot :
Bovendien wil hij de site als zijn exclusief jachtterrein erkend zien … en eist hij alle vondsten die nog (eventueel ) kunnen worden gedaan op …)
°
De vondst geeft aan dat er kort geleden nog méérdere mensensoorten op aarde rondliepen.
°
Maar Jacob gelooft daar niets van. Misschien was de floresmens wel een gewone Homo sapiens die leidde aan een of andere dwergziekte,( nota van mij ; microcephalie dacht ik ? ) meent hij.
°
Bovendien ;
°
Op Flores doen nog steeds verhalen de ronde over een volk van dwergen dat tot voor kort in de bossen leefde.
Jacob, overigens een leerling van de Nederlandse antropoloog
Gustav von Koenigswald (1902-1977), heeft aangekondigd nu zelf de opgraving over te nemen.
°
Andere paleoantropologen reageren ontzet en klagen in Science dat ze ‘uiterst ongelukkig’ zijn met de ontwikkeling. “Ik betwijfel dat het materiaal ooit nog bestudeerd zal worden,” sombert Peter Brown, de Australische onderzoeker die de ‘hobbitmens’ aan het licht bracht..
°
°
Een ondersoort( = ras ? ) die door een “proces van verkleining” (???)is gegaan ….
Met genetische verschillen als gevolg veronderstel ik ….
°
Waarschijnlijk(?) gaat teuku Jacob , enig DNA vinden op de fossielen in zijn bezit ?
°
Heilaas zal niemand deze resultaten en research kunnen kontroleren of nagaan of overdoen —> de “hobbit ” zit immers achter slot en grendel ( De schedel werd uiteindelijk terug vrij gegeven , maar was ernstig beschadigd
°
°
°
Microcephalen ?
°
…. Jacob claims the remains really belong to modern humans suffering from microcephaly which shrank their brains to the size of a chimpanzee’s.
‘It is known that many people on Flores suffered from this out-of-the-ordinary pathology but it was not the whole population,’ he said.
But Stringer said that, while sufferers of microcephaly have small brain cases, their jaws, chins and pelvis bones are of normal dimensions.
‘Everything that was found of Homo floriensis was diminutive, so I don’t see how you can substantiate the claim that these were modern little people with one particular condition. Also, the chin is that of a very primitive hominid, not a modern human. I firmly believe Brown has made a superb discovery on Flores.’
Zie verder over deze affaire en andere pop- discussies over de “hobbit
°
°
 °
 °
verdere bronnen ;
 °
Interessant is de reactie van amerikaanse ” id-ots en crato’s ” in volgende diskussiepanels en (lezers)brieven aan republikeinse (? ) kranten
 °
 °
Related Links

°
Out of africa
°
mitochondrial eve
 °
2004 -2005
Het lopende ” homo floresiensis ” onderzoek  in 2005  
°
Er  was   nog  lang  geen uitsluitsel over de positie van de ” hobbit ” : maar de hypothese dat het om een aparte mensensoort gaat en niet om een Homo sap -ras , scheen  ( tot nu toe ) de meeste argumenten en bewijsstukken te kunnen voorleggen …. waaronder weer deze nieuwste studies ( na een lange periode van stilte )
°
Een serieus artikel over de jongste bevindingen / october 2005 ) http://www.corante.com/loom/archives/2005/10/11/hobbits_again.php van de hand van Carl Zimmer ( met vele links ) en is ZEKER TE LEZEN ; door iedereen die hierover wil meekletsen
” ….In this week’s issue of Nature, the scientists describe bones from nine individuals from the Liang Bua cave. Some of the bones–parts of the right arm and jaw–belong to an individual. Other leg bones, shoulder bones, and various bits of fingers and toes come from other levels in the cave. They were laid down in the cave over thousands of years, the youngest being just 12,000 years old–around the time when our ancestors were inventing agriculture….”
 °
 ” De Morgen ”  geeft het volgende signalement
 °
 Recente ontdekkingen bevestigen het bestaan van ‘hobbits’, de kleine mensensoort die op het Indonesische eiland Flores geleefd heeft.
°
Meer nog, enkele van de beenderen van negen specimen van de Homo floresienses, zoals de soort officieel heet, die nu teruggevonden zijn, zijn ‘amper’ 12.000 jaar oud.
°
Dat betekent meteen dat de kleine mensjes, die amper een meter lang werden, nog recenter op aarde rondgelopen zouden hebben dan tot nu toe aangenomen werd.
°
Enkele jaren ( de ontdekking werd bekend gemaakt eind 2004 ) terug ontdekte een team van archeologen restanten van enkele kleine mensen in grotten op Flores. Na onderzoek bleken de beenderen een goede 18.000 jaar oud te zijn. De hobbits leefden met andere woorden nog op het moment dat de Homo sapiens al bestond. Een revolutionaire ontdekking die veel wetenschappers als flauwekul afdeden. Zij geloofden hoogstens dat het team onder leiding van Michael Morwoord van de Australische Universiteit van New England schedels teruggevonden had vanvertegenwoordigers van Homo sapiens die een vorm van dwerggroei hadden.
°
Maar de pas ontdekte botten tonen aan dat dat niet kan, zo beweert Morwood in de recentste Nature.
°
Bij de botten waren onder meer armen van een eerder teruggevonden skelet en een onderkaak. …. en de botresten oorspronkelijk van vier tot zes maar nu van minstens negen andere individuen De “nieuw ” ontdekte botten en de onderkaak tonen, net als alle andere vondsten, aan dat er geen sprake is van verkeerde proporties.
°
Hoofd, armen, benen en bekken zijn perfect geproportioneerd. Bij dwerggroei zou er wél disproportionisme zijn .
°
= Pygmee-groei/anatomie bij mensen ; …de pygmee-rassen bij homo sapiens hebben dezelfde schedelinhoud als de “normale” mensen : pygmeen hebben dus (proportioneel gezien nogal grote hoofden…
°
Bij homo floreseisnsis is dat niet het geval … Dat de oorspronkelijke vondst een pathologische vorm zou zijn ( een microcephaal met zeer kleine herseninhoud ) werd al vroeger afgewezen ( schedel-scans ) maar is nu door de vondst van de tweede onderkaak definitief naar het rijk der fabelen verhuist ….
°
Morwood en zijn team krijgt ook stilaan meer inzicht in hoe de hobbits geleefd zouden hebben. En het blijken behoorlijke Bourgondiërs geweest te zijn. In de grotten werden resten teruggevonden van onder meer een stegadon, een uitgestorven soort miniolifanten ter grootte van een pony, ratten, komodovaranen en vleermuizen. Op verschillende botten waren inkervingen te zien, andere waren ooit gekookt, wat erop wijst dat de Homo floresienses zowel slager als kok was.
°
De nieuwe ontdekkingen overtuigen echter niet alle sceptici. Sommigen blijven ervan overtuigd dat het hier NIET om een nieuwe mensensoort gaat maar wel om een afwijkende stam ( ras ) die zijn kleine gestalte overgehouden heeft aan het feit dat ze generatie na generatie in moeilijke omstandigheden op een eiland gewoond hebben…. Maar deze laatste positie wordt stilaan onhoudbaar : tenzij er opzienbarende antropologische ontdekkingen worden gedaan en /of  er een nieuw”levend ” mensenras wordt ontdekt …
°
 Nu ja de “yeti “ en “big black foot” zijn ook nog niet ontdekt … ” Nessie “ook al niet …. Lees trouwens hier ;http://www.corante.com/loom/archives/2005/10/11/hobbits_again.php
°
The key conclusion of the paper is that these fossils look a lot like the original Hobbit bones reported last year. The new jaw, for example, has the same peculiar roots on its teeth as the old one, and both also lack a chin.If the original Hobbit was just a pathological human, the authors argue, then all of these new individuals would have to be pathological too.
°
(Persbericht) Palaeontologists digging on the remote Indonesian island of Flores have turned up more bones of Homo floresiensis – the tiny hominin species unveiled last October ( 2004 ) in Nature
°
Anthropology: [1] Return of the hobbits (pp 1012-1017; N&V)    For immediate release ……
°
The new findings include another jaw bone, and the right arm belonging to the owner of the original skull found previously. in 2004 The bones provide further evidence that H. floresiensis was indeed a naturally tiny species, rather than suffering from an abnormally small brain size, reports the team, led by Michael Morwood. What’s more, dating of the remains shows that they were present on the island as recently as 12,000 years ago. H. floresiensis may also have been a proficient chef, the researchers add. Other remains found at the site showed that they butchered a small elephant-like species called Stegodon, and that they had mastered the use of fire. Harvard anthropologist Daniel Lieberman puts the findings in context in an accompanying News and Views article.
°
CONTACT Mike Morwood (University of New England, Armidale, Australia) Tel: +61 2 67 73 2357, E-mail  mmorwood@pobox.une.edu.au
°
Peter Brown co-author (University New England, Armidale, Australia) Tel: + 61 2 67733064, E-mail   pbrown3@pobox.une.edu.au
°
Richard ‘Bert’ Roberts – co-author (University of Wollongong, NSW, Australia) Tel: +61 2 4221 5319, E-mail   rgrob@uow.edu.au
°
°
Occlusal and lateral views of mandibles of and LB6/1 (ref. Morwood et al, 2005. “Further evidence for small-bodied hominins from the Late Pleistocene of Flores, Indonesia”. Nature, 437/13:1012-1017).
°
Unlike modern humans,  H. floresiensis has little in the  way of a chin

 °
 Daniel Lieberman, of Harvard University in Massachusetts, US, said further discoveries on the island would help settle the issues.
If the island-dwarfing hypothesis is correct, then the island’s earliest inhabitants should be larger than the Liang Bua fossils; and if dwarfing occurred gradually, then it might even be possible to find fossils intermediate in size and shape between H. floresiensis and its ancestor,” He wrote in a commentary in Nature. “More evidence on when Homo sapiens first arrived on Flores is also needed.  http://www.andaman.org/BOOK/chapter49/text49.htm “Further evidence for small-bodied hominins from the Late Pleistocene of Flores, Indonesia” by M. J. Morwood, P. Brown, Jatmiko, T. Sutikna, E. Wahyu Saptomo, K. E. Westaway, Rokus Awe Due, R. G. Roberts, T. Maeda, S. Wasisto and T. Djubiantono Nature 437, 1012-1017 (13 October 2005) doi: 10.1038/nature04022
Peter Brown,  says critics should answer   why
“to point you at a human mandible with the same features as those from Liang Bua. Claiming that they have the same features as small local people ( Note  ;  a subspecies  of the  homo sapiens)is simply untrue.”

And the fact that these fossils span 80,000 years makes it even harder to hold the pathology argument. According to Harvard’s Daniel Lieberman this pattern refutes the aberrant dwarf argument, which now “strains credulity,” as he writes in an accompany commentary.

°

  Vuile truuks en politiek gekonkel 
°
—> De grootste moeilijkheid is tot nu toe het verbod de opgravingen verder te laten gaan omdat de indonesische ” vandaal en jaloerse ijdeltuit ” prof . Tekeu Jacobs , zijn veto heeft gesteld en  wel in  zijn functie  van officieel ambtenaar van de  indonesische  regering in deze zaken ….
°
Hij claimt ook  de overdracht van alle nieuwe vindsten om ze in zijn kluis te kunnen opbergen (en te  “behandelen ”  zoals reeds is gebleken ) Deze antropoloog is trouwens ook de bron van de pygmee-ras theorie …. Misschien zal binnenkort DNA orderzoek (en  andere vergelijkingen ) de knoop doorhakken ?
°
Het verhaal wordt in elk geval vervolgd …En misschien worden er nog meer botten gevonden ?
of zelfs  nog andere  “dwerg-soorten ” op andere eilanden ?
 °
….. the(damaged )  bones of   Flo … The original  Homo floresiensis, aka the Hobbits, have at last been returned to the team that originally discovered them….
 °
CREATIONISTEN BLABLA Niks nieuws, weer dezelfde oude lulsmoesjes.
°
Het is een hoax, of een homo sapiens met een afwijking, of satan probeert ons te misleiden,de dateertechnieken deugenniet, etc
°
NEDERLANDS
°
* Reactie van AIG, geschreven door Carl Wieland: http://www.answersingenesis.org/docs2004/1028dwarf.asp
°Samenvatting:
Homo floresiensis is eigenlijk Homo sapiens met wat afwijkingen en ‘seculiere dateringsmethoden’ zijn onbetrouwbaar.
°
Over de onderlinge consistentie van de verschillende gebruikte dateringsmethoden wordt met geen woord gerept.
°http://www.freethinker.nl/forum/viewtopic.php?t=379&highlight=floresiensishttp://www.freethinker.nl/forum/viewtopic.php?t=2971&highlight=floresiensis waaruit dit openingsbericht van Wim Ahlers. (citaat )


Lees:

 

°http://news.bbc.co.uk/2/hi/science/nature/5021214.stm En daaraan gerelateerd: http://news.bbc.co.uk/2/hi/science/nature/6387611.stm

°

Het volgende kan onomstotelijk observeer en meetbaar worden vastgesteld: 1. Een wezen, Floresiensis, die vuur maakte, zijn doden begroef, op twee benen liep en gebruik maakte van stenen werktiuigen. Een wezen (soort) die pas recent uitgestorven is en die een anatomische fysiologie heeft die tussen de mens staat en een een ander tweebenig wezen, die inderdaad ouder gedateerd is, genaamd Homo habilis (of mogelijk Homo erectus).

°

2. In het tweede artikel is geobserveerd,/ vastgesteld dat apen, met name chimpanzees, ook gebruik maken van werktuigen. Nu was dit allang een bekend feit maar wat nieuw is in deze is dat chimpanzees ook redelijk geavanceerde wapens zoals speren maken. Dit vereist procedurematige handelingen waar over nagedacht moet worden!

°

3. Deze twee recente ontdekkingen volgen een ander, maar iets ouder, recent observeerbaar en gemeten feit op, namelijk het feit dat de Neanderthaler geen direkte voorouder is van Homo Sapiens (gemeten m.b.v. het mitchondriaal DNA, zie o.a.: http://www.pbs.org/wgbh/nova/neanderthals/mtdna.html).

°

4. Creationisten die blijven vasthouden aan de hypothese van microcephalie moeten maar eens verklaren waarom deze microcephalie patiënten een normaal gevormde hersenschorsstructuur habben, zij het ongeveer 3 a 4 keer zo klein dan de moderne mens.

°

Ik ben benieuwd hoe creationisten zich hier nu uit proberen te kletsen! Feiten die wederom specifiek de menselijke afstamming bevestigen en in het algemeen weer de evolutietheorie bevestigen…zoals elk wetenschappelijk meetbaar en observeerbaar feit in overeenstemming is met de evolutietheorie. Dit alles natuurlijk los van andere wetenschappelijk meetbare feiten die allang bevestigd hadden dat de mens en de primaat een gemeenschappelijke voorouder delen. Sterker nog! De mens is een primaat! En al weigert een creationist te accepteren dat een mens ook een primaat is dan nog moet hij 3 mensen-soorten verklaren die in het recente verleden tegelijkertijd naast elkaar bestaan hebben (Neanderthales, Floresiensis en Sapiens).

°

Het probleen voor creationisten is deze, ze moeten of: 1. Accepteren dat er in één tijdsperiode minstens 3 menselijke rassen waren…wat niet in overeenstemming is met de Bijbel! 2. Of ze moeten stellen dat de Neaderthaler en Floresiensis niet tot het menselijke ras behoren…

°

het probleem met dit laatste is dat als ze van deze stellingsname uitgaan dat ze impliciet soortvorming erkennen en dus een gezamelijke afstamming!

3. Als laatste ‘redmiddel’ kunnen ze nog verklaren dat God niet één klei-hoopje had maar drie, waar hij pats boem de mensachtigen uit sculpteerde! Waarvan één de belangrijkste klei-hoop was, onze Adam, en hij de twee andere klei-hopen, voor Neaderthales en Floresiensis, minder belangrijk achtte…immers, Gods wegen zijn nu eenmaal ondoorgrondelijk! En dan nog moeten de creationisten ‘beslissen’ of Floresiensis en Neanderthaler nu ‘mens(achtigen)’ wezens waren of niet!

°

Nb.

°

Bedenk (zie tweede artikel) dat apen al een mate van intelligentie hebben die het mogelijk maakt om redelijk geavanceerde werktuigen te maken. Overeenkomstige werktuigen zijn ook aangetroffen bij habilis en ook bij floresiensis en neaderthales (de Neanderthaler) wat natuurlijk volledig in lijn is met de te verwachten evolutionaire patronen!

°

Wat de soorten Habilis, Floresiensis, de Neanderthaler en Sapiens onderscheid van de overige primaten is dat alleen deze soorten op twee benen lopen (waarvan alleen Sapiens nog als soort bestaat). De creationisten moeten zich in allerlei ‘creatieve’ bochten wringen om de nieuwe feiten in overeenstemming te brengen met hun behoudend dogma. Nog los van het feit dat de creationisten nog nooit een passage hebben aangegeven in hun religieuze literatuur die een ‘wetenschappelijke’ verklaring, dus een meetbare en observeerbare verklaring bevat, die de bovenstaande nieuwe feiten kan ondervangen.

 

°
De Flores-mens heeft  in geologische termen amper de twintigste eeuw gemist !
°
Bepaalde verhalen/mythes bij de lokale bevolking, die eventueel zouden kunnen verwijzen naar deze kleine mensachtigen. , vertelden  dat de  “mensen”  de dwergmensjes die in een grot leefden ’s nachts gedood hadden.  Moesten deze verhalen waar zijn (en daar zijn dus voorlopig geen bewijzen voor), dan zou dit echt wel spijtig zijn.
 °
Een ander verbazingwekkend wezen, de moa is in de 16de eeuw door de Maori naar de fossielen verwezen !
De ontdekking van de Flores-mens is  uiteindelijk een detail in de menselijke evolutie, al weze het een belangrijk detail.
°
Als ze nog geleefd hadden, zou dat dan veel verschil gemaakt hebben, behalve de sensatie ?
°
Mark Nelissen had hun gedrag kunnen bestuderen, en een paar boeiende hoofdstukken bijschrijven aan “De Bril van Darwin” ! Maar ik denk niet dat dat het wetenschappelijke wereldbeeld fundamenteel zou veranderd hebben …
°
Het wereldbeeld van de meeste mensen zou m.i. toch drastisch anders zijn, moest er een naaste verwant van de H. sapiens sapiens rondlopen op deze aardkloot.   ?
*Men denke  dan vooral aan fundamentalistische religieuzen. *Misschien dat de kijk op( en behandeling van ) mensapen ook zou veranderen. ? ..
 °
Digit     Twijfel over de invloed op het wereldbeeld van fundamentalisten !
°
En daarzijn goede redenen voor : in een vrij recent verleden (18de en 19de-20ste eeuw) zijn de creationisten immers reeds geconfronteerd met “wezens” die (volgens hun tenminste) zowat het  midden hielden tussen mens en aap !
Na de ontdekking van Amerika heeft immers de discussie gewoed of indianen al dan niet een ziel hadden.
Deze vraag is equivalent met de vraag of het mensen, dan wel dieren waren. Kwestie was :bekeren of uitroeien ?
De Jezuïeten hebben hier een doorslaggevend rol gespeeld met hun missies in Amerika (film : “The Mission”), en op die manier ontelbare indianen het leven gered door te ijveren voor een “menswaardige” behandeling.  “Menswaardig” volgens de normen van die tijd, welteverstaan !
Dezelfde vraag, maar dan over de negers, heeft voor verdeeldheid gezorgd in de VS !
Sommigen rechtvaardigden de slavernij door te stellen dat negers géén mensen waren, maar een soort apen. Geschapen ten dienste van de “échte mensen” !
Ik durf er flink wat op verwedden dat je ook vandaag nog klu-klux-clanners kunt vionden die er precies zo over denken.
Vandaar dat ik denk dat de fundi’s, bij een ontmoeting met bv bigfoot( de yeti  of nog een levende flores hobbit ), zich enkel zouden afvragen of zoiets  monsterlijk een ziel kan hebben, en of het soms  niet door Satan geschapen is om de mens aan het twijfelen te zetten.
 °
Maar evolutie ? Nee toch !
 °
Natuurlijk heb je de middenmoot, waar wél wat verschuivingen zouden optreden. Voor wie het inderdaad een bijkomend bewijs van evolutie zou zijn. Maar dan wél evolutie als een mechanisme in god’s schepping. So, what ?
°
Humor en meer creationisten babbel
°

Creationistische “duivels in het wijwatervat ”  De vondst van homo floresiensis is een uiterst belangrijk gegeven en een wijd verspreid media gebeuren geworden ; de creationisten moeten wel reageren … 1.- De eerste reacties van het AIG en consoorten zijn ronduit verschikkelijke duimzuigerij en kontdraaierij …. Zie hier wat er daar allemaal word gebrouwen ; —-> http://www.pandasthumb.org/pt-archives/000607.html#more 2.- Het is echter nog veel interessanter te lezen wat voor een menagerie aan “alternatieve” experten ( en de routineuze ” misquoting ” )er nu weer word opgevoerd : —-> Mis vooral niet de “Comments ” die onder het artikel staan =  Het was weer eens schieten met veel losse flodders. Van orang-oetangs tot dwerggroei etc. 

°

Echter waar zitten de creationisten vooral mee in hun maag. ?

°

Als de flores mens een reguliere zijtak is van de hominiden dan is onze verwantschap met de chimpansee niet te ontkennen. Of is er sprake van selectieve degeneratie (stopwoord voor sommige crea’s). Waarom gaat dit op voor één menselijke soort!! En niet voor de gehele mensheid. Was de “schepper” even het spoor bijster op Flores. En moest er voor het mini-olifantje een passende “jockey” gemaakt worden.

°

Creationisten

http://www.godandscience.org/evolution/hobbit.html

“De Kenmerken schijnen een kombinatie te zijn van australopithecinae  en Homo Sapiens ___ in mini uitvoering . Het is duidelijk dat het hier geen dwerg-ras van  homo sapiens betreft …Het brein is te klein en de schedel heeft vele primitieve eigenschappen , met uitzondering van de tanden , het schepsel bezit ook een achterhoofdgat en  karakteristieken in het skelet  ( dat de rechtopgaande gang  aannemelijk maakt )maar die niet  volledig modern zijn …

 

Nota :

°

Creationisten hebben steeds beweerd dat australopithecinen “echte apen “zijn  : —->In feite wil dit artikel suggereren dat de H floresiensis een afstammeling is van australopithecus (  volgens de Yec -scientific creationists een apensoort , waarvan de mens die apart is geschapen niet afstamt )

°

Bovendien schijnt ( volgens  de creato’s ) de wetenschap van de “evolutie” te zijn “ontredderd” door deze ontdekking : de ontredering is echter in het kamp van de creationisten te vinden …. ) Niettemin bevat het artikel ook ( lezenswaardige  en goed gedokumenteerde -) waarheden ; het is immers een kenmerk van de moderne creationistische apologetiek ;  waarheid  ( quotes van “echte ” wetenschappers ) en verdichtsel ( interpretaties , speculaties  en dogma’s )met elkaar te vermengen …. Het resultaat is een betoog vol halve waarheden …

°

Schedel H. floresiensis vs. H. erectus

°

De schedel van  Homo floresiensis is het best te vegelijken met die van    Homo erectus : De flores schedel is gewoon kleiner  1(Brown, P., T. Sutikna, M. J. Morwood, R. P. Soejono, Jatmiko, E. W. Saptomo and R. A. Due. 2004. A new small-bodied hominin from the Late Pleistocene of Flores, Indonesia. Nature 431: 1055-1061.

°

Homo erectus ? Sommige  creationisten  hebben beweerd  dat  homo erectus een ondersoort is van homo Sapiens  … Dat is de reden waarom ze NIET kunnen aanvaarden dat H.forensiensis  een afstammeling is van H.erectus … De Flores-schedel  verschilt van moderne mensen door de vorm van het cranium en de kin ( zie hieronder ) De foramen magnum  is iets lmeer verschoven dan dat bij moderne mensen

Australopithecus africanus Homo erectus Homo floresiensis Homo sapiens
Australopithecus africanus skull Homo erectus skull Homo floresiensis skull Homo sapiens sapiens skull
Australopithecus africanus skull Homo erectus skull Homo floresiensis skull
Australopithecus africanus skull Homo erectus skull Homo floresiensis skull Homo sapiens sapiens skull
For features comparison, skulls are not to scale

Rechtopgaande gang : De beenderen van achterste lredematen  vertonen zowel primitieve als moderne  kenmerken :

°

—->Het ilium steekt verder uit dan bij moderne mensen , waar het ook meer vertikaal is geplaatst  …

°

—->De benen bezitten prominente spieraanhechtingspunten , wat gedeeltleijk kan zijn veroorzaakt door hun kleine gestalte …

°

—->Het bovenste gedeelte van het femur ( de kleine  trochanter,) gelijkt meer op dat van de moderne mens dan op dat van  H. erectus en  A. africanus. Maar , de femur-schacht is  langer , en gelijkend op A. africanus. .Veel andere afmetingen van het femur vallen ook binnnen het A. africanus model .

°

—->Het femur eindigd aan de knieverbinding in een bicondylaraale hoek die ook is gevonden bij  A. africanus.

°

—-> De tibia  bezit enkele karakteristieken die meer aan chimpansees dan aan het genus  Homo doen denken .

°

H. floresiensis een  ras ; een “ endocriene ” dwerg ; of een  “microcephaal “ ?

°

Sommige creationisten speculeren dat de H. floresiensis  een dwerg mens is  .

°

Maar dwerggroei in homo sapiens is het gevolg van verschillende factoren ___geen enkele resulteert in  de  karakteristieken die bij  H. floresiensis.zijn gevonden Bij Afrikaanse pygmeeen , is de dwerggroei het gevolg van een genetisch defekte groei faktor  l ( insuline-achtige  IGF-1) , die wel een kleinere gestalte veroorzaakt terwijl de  herseninhoud gelijk blijft . Dwerggroei door klier-defekten  en  bekende ontwikkeling tot  microcephale dwergen (http://www.creationsciencemovement.com/news/2004/08.html ) resulteren ook al niet  in de eigenschappen van  H. floresiensis.

°

Daarom is dit schepsel geen “kleine ” homo sapiens , maar een aparte en unieke species Vooral de slotzin van het artikel  is relevant voor de creationistische  ontreddering  die deze vondst heeft veroorzaakt

” ….Biblical creation says that all species are specially created by God. Therefore, we would not expect to find any intermediates between Homo erectus and Homo floresiensis. Paleoanthropologist are actively searching the Island of Flores and surrounding islands to find similar or intermediate species.My prediction is that they will find more examples of Homo floresiensis, but no intermediates. Time will tell…”

 

Creationisten hebben hier een voorspelling  gemaakt … waarvan akte                   Natuurlijk is het vragen naar “tussenschakels ” een zoveelste teruggrijpen op een retorisch truukje …   Er zijn vroeger  al  dwergvormen /afstammelingen van homo erectus gevonden in afrika Het lijkt er op dat homo erectus een erg  variabele  soort ( of zelfs soortengroep )was die diverse keren de voorouder lijkt te zijn  geweest  van “nieuwe “hominide soorten ( zeker wanneer die allopatrisch afgezonderd raakten van de hoofdgroepen ) waaruit ook  Homo sapiens is ontsproten

In Kenia zijn schedeldelen gevonden van een Homo erectus van ongeveer 950.000 jaar oud. Het gaat om het voorhoofdsbeen, met de karakteristieke wenkbrauwbogen en een deel van het slaapbot. Ze behoorden tot de schedel van een verrassend kleine (bijna) volwassene.  In de anatomische details combineert de schedel allerlei kenmerken van andere Homo erectusschedels uit eerden en later tijd. Daardoor wordt de schedel, die de naam kml-ol 45500 kreeg, gezien als een nieuw belangrijk bewijs voor de grote diversiteit van deze vroege mensensoort…… . (science, 2 Juli) (Overgenomen uit NRC Handelsblad van Zaterdag 3 Juli 2004. )

°

Creationisten  ” proberen zich te redden “ http://newcovenant.blogspot.com/2004/10/flores-man-and-imago-dei-evolutionary.htmlhttp://www.creationsciencemovement.com/news/2004/07.html

°Press                                 

http://www.theage.com.au/articles/2004/10/28/1098667904973.html?http://www.guardian.co.uk/life/feature/story/0,13026,1337198,00.html

°

This is bad news for creationists who insist on the literal truth of the Bible.  The existence of Florence shows the fact of species diversity, and the difficulty of separating human from ape on the evolutionary scale. http://www.guardian.co.uk/life/science/story/0,12996,1340665,00.html

°

De “Mens” —>  

°

De eerste mens die het sterkst lijkt op de pas ontdekte Homo floresiensis, leefde 1,8 miljoen jaar geleden en werd in 1991 ontdekt in de Kaukasische republiek Georgië. ( de  DMANISI schedels ) —–> http://news.bbc.co.uk/2/hi/science/nature/745080.stm

Near-complete skull: This was an adolescent female

http://www.talkorigins.org/faqs/homs/d2700.html

dmanisi

   d2700-side

D2700, Homo georgicus

°

http://www.amarcord.be/georgia/dmani01.html        

http://sesha.net/eden/NIEUWS/2002-02.asp

°

Het is mogelijk dat de Homo floresiensis afstamt van de Georgische hominide, wellicht de Homo ergaster, waarvan zo goed als vast staat dat het een vroege vorm of nauwe verwant is van een van de meest wijdverspreide en belangrijkste vroege mensensoort, de Homo erectus. Zowel de Homo floresiensis als wij zijn leden van de menselijke soort. Wanneer de Homo ergaster een voorouder van de Homo floresiensis blijkt, dan zijn wij de rechtstreekse neven van de Homo floresiensis. Onze menselijke stamboom begint acht miljoen jaar geleden toen onze voorouders zich afsplitsten van wat later het chimpanseegeslacht zou worden. De laatste jaren werden tijdens opgravingen in Afrika de twee oudste bekende vermoedelijke hominiden blootgelegd.

°


°

In de afgelopen hondervijftig jaar zijn er twintig soorten fossiele mensachtigen gevonden. Afrika is het continent waar de meeste, en tevens oudste, vondsten zijn gedaan, maar ook Europa en Azië hebben fossielen van vroege mensachtigen opgeleverd. Paleoantropologen hebben de neiging om bij nieuwe vondsten vaak ook een nieuwe soortnaam te verzinnen. Zo telt het geslacht Australopithecus inmiddels al zeven soorten. De verschillen zijn soms vaak erg klein. Volgens veel paleoantropologen zelfs te klein om maar meteen te zeggen dat het om een nieuwe soort gaat. Hier volgt een overzicht van de momenteel gebruikte soortnamen.

http://www.natuurinformatie.nl/nnm.dossiers/natuurdatabase.nl/i002543.html

Genus Soort Ouderdom in miljoen jaren Gebied Eerste beschrijving
Homo
Homo sapiens 0,15 – heden Wereldwijd 1868 (fossiel)
Homo neanderthalensis 0,2 – 0,03 Europa, Midden Oosten 1859
Homo heidelbergensis 0,5 – 0,1 Afrika, Europa 1908
Homo antecessor 0,8 Spanje 1997
Homo erectus 1,7 – 0,25 Afrika, China, Indonesi챘 1894
Homo ergaster 1,7 – 1,5 Zuid en Oost Afrika 1970
Paranthropus
Paranthropus robustus 1,9 – 1,5 Zuid Afrika 1938
Paranthropus boisei 2,3 – 1,4 Oost Afrika 1959
Paranthropus aethiopicus 2,8 – 2,3 Oost Afrika, Kenia 1986
Kenyanthropus
Kenyanthropus platyops 3,5 Oost Afrika, Kenia 2001
Australopithecus
Australopithecus (Homo) habilis 1,9 – 1,6 Zuid en Oost Afrika 1964
Australopithecus (Homo) rudolfensis 2,4 – 1,8 Oost Afrika 1973
Australopithecus garhi 2,5 Oost Afrika, Ethiopi챘 1999
Australopithecus africanus 3,0 – 2,3 Zuid Afrika 1925
Australopithecus bahrelghazali 3,5 – 3,0 Centraal Afrika, Tsjaad 1995
Australopithecus afarensis 3,6 – 2,9 Oost Afrika 1975
Australopithecus anamensis 4,2 – 3,9 Oost Afrika 1995
Ardipithecus
Ardipithecus ramidus 5,8 – 4,4 Oost Afrika, Ethiopi챘 1994
Orrorin
Orrorin tugenensis 6 Oost Afrika, Kenia 2001
Sahelanthropus
Sahelanthropus tchadensis 7 – 6 Centraal Afrika, Tsjaad 2002

HET BEGON ACHT MILJOEN JAAR GELEDEN In 2001 de zeven miljoen jaar oude Sahelanthropus tchadensis http://www.natuurinformatie.nl/nnm.dossiers/natuurdatabase.nl/i002544.html

http://www.scienceinafrica.co.za/2001/nov/ancestor.htm 

  Replica of a 3.2- to 3.5-million-year-old Kenyanthropus platyops skull found by anthropologist Meave Leakey in 1998 at Lomekwi, near Lake Turkana, Kenya.  en     in 2000 in Kenia de 6,5 miljoen jaar oude Orrorin tugenensis.

 Dit is alles wat er van Orrorin Tungenensis  bekend is:orrorin1  is thus far represented by only a few fragments of bone — some isolated teeth, parts of two lower jaws, and fragments of arm and leg bones, representing in all perhaps five individuals (see above).   http://www.wsu.edu/gened/learn-modules/top_longfor/timeline/05_o_tugenensis.html Vrij weinig dus, maar de kop van het stuk bovenbeen staat op een hoek die voorkomt bij rechtoplopende primaten, en daardoor weten we dat Orrorin op de ‘human line’, zat, rather dan op de ‘ape line’. Hier is een link met veel info: http://www.modernhumanorigins.com/tugenensis.html


Dit soort wezens lijkt zich 4,2 miljoen jaar geleden geleidelijk aan ontwikkeld te hebben tot de australopithecines, een reeks hominide soorten die meer rechtop liepen dan hun voorouders en ook een menselijker gebit hadden.        a.  africanus Sommige australopithecines lijken 2,6 miljoen jaar geleden begonnen te zijn met het maken van stenen werktuigen. 2,4 miljoen jaar geleden heeft een groep zich wellicht ontwikkeld tot de eerste menselijke, eerder dan mensachtige, wezens. Dat nieuwe geslacht werd Homo genoemd en beschikte over grotere hersenen en meer menselijke lichaamsverhoudingen. Voor zover wetenschappers wisten was het hominideverhaal uitsluitend Afrikaans. Maar twee miljoen jaar geleden verscheen een Homo-soort met een meer menselijke manier van lopen, de Homo ergaster (een vroege vorm van de beter bekende Homo erectus).       H  erectus Sommige leden van die soort verlieten Afrika 1,8 miljoen jaar geleden en arriveerden in Georgië. Anderzijds evolueerden de leden van de Homo ergaster-/ Homo erectus -soort die in Afrika achterbleven, 150.000 jaar geleden via de vroege tussensoort(?) Homo heidelbergensis tot onze soort, de Homo sapiens. De stamouders van de Homo sapiens zorgden voor een nageslacht :  de Neanderthaler die in Europa en delen van Azië leefde. De Neanderthalers, die 25.000 tot 30.000 jaar geleden uitstierven, waren onze broers en zussen in de evolutie. (DK) en in  2004 dook dus homo floresiensis op


PZ Myers October 27, 2004 Comments (5)

A long-lost cousin has been discovered, Homo floresiensis, or Flores Man. It’s especially dramatic for a number of reasons. It’s relatively recent, with the youngest specimen only 18,000 years old, but it is most closely related to Homo erectus. This species was also minute, only 3 feet tall, and tiny-brained. Here we have a group of small, specialized human relatives, living contemporaneously with Homo sapiens, on isolated islands in Indonesia. It’s like discovering that Munchkins were real.


1.- Nieuwe archeologische ontdekkingen van Australische en Indonesische wetenschappers op het Indonesische eiland Flores wijzen uit dat een oude menselijke soort zeker overleefde tot 12.000, 13.000 jaar geleden. 2.-Meer nog, volkskundige gegevens die op hetzelfde eiland werden verzameld, suggereren dat ze misschien overleefden tot 150 jaar geleden. 3.- Zoölogisch materiaal van een ander Indonesisch eiland, Sumatra, wijst erop dat een mogelijk vergelijkbaar intelligente soort van tweevoeters nog altijd springlevend is in afgelegen junglegebieden. Het sterkste bewijs, het archeologisch materiaal, toont onmiskenbaar aan dat onze soort, de Homo sapiens, ten minste tot 11.000 voor Christus de planeet deelde met een totaal andere mensensoort, een dwerghominide van een meter lang met fysieke kenmerken die ge woonlijk gedateerd worden als 1,5 tot 4 miljoen jaar oud. De wetenschappers werken aan de Australische universiteiten van New England en Wollongong en vonden beenderresten van vier tot zes individuen. Hun piepkleine ge stalte, kleine herseninhoud, terugspringende kin, de vorm van hun voorste kaakkiezen en de schedelbasis rond het oor doen sterk denken aan de eerste Australopithecus, een hominidetype waarvan gedacht werd dat hij meer dan 3 miljoen jaar geleden in Afrika leefde. Anderzijds doen de schedelboog, het platte gezicht en de kleinere kiezen denken aan de Homo erectus, die tussen 1,8 miljoen jaar en mogelijk 300.000 jaar geleden leefde.


http://www.scientificamerican.com/media/inline/62823310-B3B5-84BD-02C0114CD037093B_1.jpg

DENTAL WORK?: The lower left first molar of the hobbit is claimed to have a filling–an observation that other hobbit researchers say is refuted by this photograph. PETER BROWN University of New England http://www.scientificamerican.com/article.cfm?id=flores-hobbit-root-canal


Het is best mogelijk dat de kleine gestalte van het wezen van Flores (en zijn evenredig kleine hersenen) tien- of honderdduizenden jaren geleden vorm kreeg op het kleine eiland. Soorten die op kleine eilanden leven worden afgeschermd van roofdieren op het vasteland.Een grote gestalte blijkt dan geen evolutievoordeel, dus ‘krimpen’ ze tijdens de evolutie. Evolutionaire Pygmeegroei – ontwikkelingen   zijn reeds meerdere malen vastgesteld  in de afstammingslijnen van  soorten die eilanden koloniseerden … Blijkbaar  geld dat dus ook voor de mensen-struik Het lijkt erop dat deze zeer vroege menselijke wezens overleefd hebben tot minstens 11.000 v. C. maar het archeologisch bewijsmateriaal wijst er sterk op dat ze geavanceerde stenen werktuigen maakten, waaronder hakmessen, messen, naalden, schrapers, en zelfs speerpunten vastgemaakt aan houten staven. WERKTUIGEN  Die stenen werktuigen, die samen met de beenderresten ge vonden werden in een grot in Liang Bua op Flores, lijken sterk op de werktuigen die gemaakt werden door gewone mensen van onze soort uit het stenen tijdperk, de Homo sapiens.

HET SPOOK VAN VIRCHOW
3/06/2006 ( Eos )
Door zijn kleine schedelinhoud werd de ‘hobbit’niet in staat geacht enige noties van menselijke cultuur te kunnen ontwikkelen.
Sommige wetenschappers dachten zelfs dat het om een gewone homo sapiens ging met een hersenaandoening. Beide hypotheses worden nu tegengesproken door onderzoekers van de Universiteit van Canberra in Australië.
Zij vonden nml scherpe behandelde vuurstenen, wat erop wijst dat onze ‘neef’ ook gebruiksvoorwerpen kon vervaardigen.
Bovendien vergeleken ze de stenen voorwerpen met vondsten van duizenden jaren vroeger. Daaruit bleek dat er een continue traditie bestond in het behandelen van de vuurstenen.

the Hobbit team takes on the skeptics again.
They’ve analyzed all the old tools from Flores–the original 1994 cache and another trove that turned up not far away in 2004. (This picture shows the front, back, and side view of one of the 2004 finds.) New dating shows that some of these 507 tools date back at least 840,000 years ago. The scientists compared them to the 3626 younger tools found with the Hobbit bones. The scientists found that the two sets of tools share many things in common. They were typically made from volcanic rocks found along rivers. The tool makers knocked off bits from these rocks in a similar fashion, creating a front and back face and sharpening the edges. In some cases they seem to have used anvils–setting their tools-in-the-making on other rocks before banging on them. Both sets of tools include distinctive kinds of tools, such as “perforators” with a long spike extending from a rounded base. The simplest explanation for these similarities, the authors conclude, “is the stone artefacts from Mata Menge and Lui Bua [the old and new tool sites] represent a continuous technology made by the same hominin lineage.”


Science publiceert het artikel (pdf) van Robert Martin on line.

Nieuw is zijn stelling niet (zijn bewijs overigens wel).Een oudere studie, ook gepubliceerd in Science, wijst de pygmee-met-een-afwijking-theorie van de hand na een studie van dezelfde schedel. De ontdekkers doopten hun vondst, in Nature, terecht homo floriensis (lees ook Schedel van hobbit snoert critici de mond). William Jungers van de Stony Brook universiteit in New York verwijst het nieuwe onderzoek van Martin in ieder geval naar de prullenmand. Zijn redenering, opgeschreven door Science, is vrij simpel: er zijn overblijfselen gevonden van een aantal kleine ‘hobbits’. Dus, als Martin gelijk heeft, was er op Flores 18.000 jaar een dorp vol idioten met een zeldzame schedelafwijking. De kans daarop is klein. De discussie zal nog wel een aantal jaar voortduren

Het lijkt erop alsof het spook van
Rudolf Virchow terug ronddoolt in de paleoantropologie
Robert D. Martin,

Noot :
*De vraagstellingen over de status van de flores-vondsten  hebben misschien  ook  iets  te maken met  heikele  plausibiliteit -kwesties in verband met de effecten van deze gegeven  (veronderstelde)hersencapaciteiten en hun verspreiding  in de populatie
In de Verenigde Staten zijn er minder dan 500microcephalen . Wij spreken dan over een aantal geconstateerde gevallen  binnen een bevolking  van  300 miljoen mensen.
In  de(minder dan )10.000 jaar die  de sedimenten in de Lia Buang grot documenteerd ,  moet het totale aantal  flores  mensen die de  volwassen leeftijd op het eiland bereikte , veel kleiner geweest zijn.
Natuurlijk konden  strenge dieetproblemen en  genetische defekten deze pathologieeen  meer  frequenter  doen voorkomen   in die populaties , maar de waarschijnlijkheid op overleven in het  volwassen  stadium  van een  microcephaal  in een jager- verzamelaar  maatschappij en is eg  klein.
Er zijn nog andere  vondsten gedaan  : post-craniale l-overblijfselen van andere individuen van dezelfde grootte
Men kan toch moeilijk blijven  vohouden  dat  al deze  individueen ( 10/9 ?http://archaeology.about.com/od/earlymansites/a/flores2.htm )  microcephalen waren ?  of  dat een  plaatselijk ” ras  eiland-pygmeen ” van te kleine moderne mensen met microcephale aandoeningen ___ een  veel voorkomend  degeneratief kenmerk?  ____zowel de (LB -l )schedel ( van een volwassen  vrouwelijk exemplaar )  als  de  kaak  van een tweede microcephaal (LB6/1  )heeft geleverd  ?
http://johnhawks.net/weblog/fossils/flores/flores_update_oct_2005.htmlQuote :


….The paper discusses three important specimens. The first is the adult mandible LB6/1. In its overall size and morphology it is similar to the mandible of LB1, reported last year. Like LB1 it lacks a chin and Morwood et al. (2005:1013) compare its symphyseal morphology to Dmanisi D211. Overall, the mandible is slightly smaller in tooth size and corpus size compared to LB1, and its ramus is quite a bit shorter. LB6/1 is part of a partial skeleton. The other elements are not described in the paper, but they are listed: a portion of proximal ulna, a partial right scapula, a foot bone, one each of finger and toe bones, and a complete radius 157mm long. That’s a short radius — barely more than 6 inches. It was broken during life and healed.


* De microcepohalen -theorie  is een weinig  geschikt scenario. Natuurlijk   is het aanvaardbaar om met een hypothese  niet akkoord te gaan,  maar  dat kan slechts  serieus genomen worden  als  een beter alternatief kan worden  voorgesteld  …

Ook antropologen en ethnologen kunnen  supplementaire   “bezwaren” inbrengen ;

* Eigentijdse jager-verzamelaar culturen doden routinematig zuigelingen geboren met teveel handicaps ____ zelfs tweelingen (en hun moeders )worden gedood of achtergelaten ____eenvoudig weg omdat denoodzakelijk mobiele groep niet de middelen heeft om deze mensen te vervoeren of te handhaven. noch zich een verspilling van basisgoederen kan veroorloven binnen de harde levens-omstandigheden
Een duizend jaar geleden oude homo sapiens (of erectus of australopithecus ? ) groep eilandbewoners zou dat niet hebben gedaan ? Of misschien waren deze achtergelaten individueen microcepahelen toevallig toch een groepje overlevenden in een beschermende omgeving/werkplaats, (instelling ?) “lia buang ” geheten ? _ hoe dan ook, waar zijn de normale individuen ?
(Het kan natuurlijk altijd wél …. Maar dat is een niet direkt  zomaar   een   falsifeerbaar  argument , net zoals de meeste in het nog lopende  onderzoek ….)
*Wat is er trouwens  geworden van de zogenaamde DNA testen ( in Duitsland meen ik  )?
1

* Er is  echter  geen DNA op LB1 meer te vinden (met de huidige technieken ) omdat
Teuku Jacob van de Universiteit van Gadjah Mada in Yogyakarta, Java, niet alleen naar verluidt enkele beenspecimens vernietigde, maar hij lijmde  zelfs één gebroken been samen  om de schade te maskeren.
Jacob waste /reinigde ___naar verluidt____ (en loste daarbij veel materiaal op , nog op de vondst aanwezig ) de LB1 schedel met aceton zodat het onmogelijk is gemaakt om, om het even welk DNA staal dan ook , nog voor analyse te kunnen gebruiken …
.
2
* Dr Martin en anderen negeren de andere 6 – 9 individuen die aan de basis liggen van de bekende Homo floresiensis vondsten .
Vele eerder al gepubliceerde en geconstateerde (niet in de homo sapiens pygmee- ras inpasbare ) eigenschappen van de fossielen worden door het microcephaal kamp gewoon genegeerd en wel om hun visie op te dringen en vooral om het bestaan van een nieuwe” homo soort ” ten val te brengen. ….Jammer genoeg, zijn de media er alweer als de kippen bij om deze sensatie als ” alerlaatste “primeur te brengen en de subjectieve “gevoel” – mening van DR Martin als “feitelijk en ondersteund ” laatste woord in de affaire te brengen ….Terwijl het niets anders is dan een zoveelste ” herhaling “van het eerder reeds geopperde en afgeschoten standpunt ….
Het begint zelfs zeer sterk te gelijken op de “strijd” die indertijd ook de eerste neanderthaler-vondsten wilden herleiden tot een paar pathologische / rachitische ” kozakken ” krom van jicht en reumatiek en uiteindelijk gestorven in hun grotten waarin ze zich verscholen als verwilderde dieren

The accompanying paper on the archaeology also shows the tools found with these little hominids; these weren’t simple apes. They were making some wicked weapons and carving tools. http://pharyngula.org/index/weblog/comments/homo_floresiensis/ http://pandasthumb.org/pt-archives/000582.html The accompanying paper on the archaeology also shows the tools found with these little hominids; these weren’t simple apes. They were making some wicked weapons and carving tools.

flores-tools


Toch had de hominide van Flores (door de ontdekkers Homo floresiensis gedoopt), een veel kleinere hersencapaciteit, vergelijkbaar (in verhouding tot lichaamsgestalte) met die van de eerste mensen als de Australopithecines en de Homo habilis, die slechts rudimentaire stenen werktuigen maakten, veel primitiever dan die van de Homo sapiens of de werktuigen die blijkbaar gemaakt zijn door deze pas ontdekte hominide van Flores. De enige andere verklaring voor de aanwezigheid van deze geavanceerde stenen werktuigen is dat ze geproduceerd zouden zijn door de Homo sapiens uit het stenen tijdperk (onze soort), maar de oudste werktuigen van Flores zijn 90.000 jaar oud en volgens de huidige gegevens arriveerde de Homo sapiens pas 50.000 tot 60.000 jaar geleden in Zuidoost-Azië. “Al het materiaal wijst er voorlopig op dat de stenen voorwerpen op Liang Bua die ouder zijn dan 12.000 jaar, allemaal gemaakt werden door de Homo floresiensis”, zegt Mike Morwood. Hij is archeoloog aan de Australische universiteit van New England en staat aan het hoofd van het onderzoek op Flores. De volkskundige sporen van de Homo floresiensis zijn mogelijk betekenisvol. Inwoners van Flores zeggen dat er tot 150 jaar geleden kleine harige ‘mensen’ van een meter groot leefden die voedsel van hen stalen. Ze stonden bekend als de ebu gogos (letterlijk vertaald: ‘grootmoeders die alles eten’). Ze werden getolereerd tot ze een baby stalen en opaten. Op dit moment is het niet te bewijzen of de ebu gogo een pure mythe is, of een werkelijke herinnering aan de Homo floresienses. “Het volkskundig materiaal doet het vermoeden rijzen dat de Homo floresiensis overleefde tot in de 19de eeuw. Het zou zelfs mogelijk kunnen zijn dat hij ook vandaag nog leeft in een afgelegen junglegebied van het eiland”, zegt dr. Bert Roberts van de universiteit van Wollongong, die eerder deze maand gesprekken had met de inwoners. Op Flores zijn nooit zulke wezens gesignaleerd, althans niet sinds de 19de eeuw. Op dezelfde eilandengroep, op het veel grotere eiland Sumatra, werden wel waarnemingen gedaan van een klein, harig aapachtig wezen van 1,20 meter. Het wezen was onbekend voor de wetenschap. Sommige zoölogen vermoeden dat enkele honderden exemplaren overleven in de afgelegen oerwouden in het binnenland van Sumatra, maar tot nog toe werd geen enkel exemplaar gevangen of onderzocht door wetenschappers. Orang Pendek ? ” …Het is niet ondenkbaar dat ze zelfs vandaag nog leven in afgelegen junglegebieden…” Mogelijk leeft er nog tweede ‘mensensoort op Sumatra ? Als de Homo floresiensis vandaag nog leeft, dan is dat meer dan waarschijnlijk in het binnenland van het grootste Indonesische eiland Sumatra. Zelfs in de koloniale tijd, in de 19de en vroege 20ste eeuw, werd melding gemaakt van een onbekende tweevoetige aap die er leefde, diep in bossen. De inwoners van Sumatra noemden hem de Orang Pendek (kleine persoon). Een expeditie in 1995-1997, geleid door de Britse milieubeschermer Debbie Martyr, slaagde erin om hem ten minste vijf keren kort te zien. Ook zijn kenmerkend geluid werd gehoord, vijftien keren op tien verschillende plaatsen. Een van de expeditieleden was de Indonesische primatenexpert Ahmad Yanuar. Hij werkt als postgraduaatstudent aan een doctoraat over gibbons aan de universiteit van Cambridge. De promotor van Yanuar in Cambridge is dr. David Chivers. Hij houdt zich al lang actief bezig met de Orang Pendek. In het kader van de ontdekkingen op Flores moeten we de echte identiteit van de Orang Pendek van dichterbij bekijken. Geen enkel exemplaar werd ooit onderzocht door wetenschappers. “Veel mensen gingen er altijd van uit dat het om een onbekende apensoort ging. Maar omdat het tweevoeters zijn en rechtop staan en gezien de ontdekkingen op Flores, is het niet ondenkbaar dat het een menselijke soort is”, zegt professor Chivers. Qua uiterlijk houdt de Orang Pendek het midden tussen een gibbon en een orangoetang, maar hij lijkt altijd rechtop, op twee benen te lopen. Homo floresiensis (reconstructed, at the Swedish Museum of Natural History) There’s also an article on Flores on the National Geographic site, National Geographic provided funding for the research, and are going to be airing a documentary on the subject next year.   Links : http://www.sciam.com/article.cfm?chanID=sa003&articleID=000B7CEA-EA31-117E-AA3183414B7F0000 http://www.nature.com/news/specials/flores/index.html http://pandasthumb.org/ http://pharyngula.org/index/weblog/comments/homo_floresiensis/ Carl Zimmer  : http://www.corante.com/loom/archives/026745.html

 John Hawks offers his take: deformed human
TWIJFEL OVER ECHTHEID  VONDSTEN  ….22 augustus 2006
Eerst was het de belangrijkste antropologische vondst van de eeuw, maar inmiddels is er grote twijfel ontstaan. Zijn op het Indonesische eiland Flores nu wel of niet de overblijfselen van een Hobbit gevonden.

Wetenschappers dachten in 2004 een compleet nieuw mensenras te hebben ontdekt, omdat dit ras zou bestaan uit louter kleine mensjes werden het al snel Hobbits genoemd. Maar nieuw “onderzoek”  beweert dat het waarschijnlijk gaat om een familielid van de pygmee, de voorloper van het pigmeën-volk dat ook nu nog een nabijgelegen eiland bewoond. Jagers en verzamelaars // “De allereerste vraag die ik en mijn collega’s onszelf stelden was: Hoe kan iemand dit ooit gaan geloven”, verklaart Robert Eckardt van de Universiteit van Pennsylvania. “Iedereen hoopte dat er een nieuw mensenras was ontdekt, de kritische kanttekeningen werden daarom nog wel eens vergeten”. Volgens de onderzoekers is het eilandje Flores te klein om een compleet nieuw mensenras te herbergen. De Hobbits zouden jagers en verzamelaars zijn, ook hier zou het eiland niet aan kunnen voldoen. Daarom konden de mensen niet genetisch zijn geïsoleerd en is er dus ook geen sprake van een nieuw ras. Andere wetenschappers    meenden  al eerder  dat de vondst gewoon uit mensenbotten bestond, maar dat deze mensen misschien waren geboren met een genetische afwijking of leden aan een ziekte. Bizarre wending Het verhaal nam een bizarre wending toen Teuku Jacob van de Gadjah Mada Universiteit in het Indonesische Yogyakarta de 13.000 jaar oud beenderen opeiste en alleen een paar bevriende wetenschappers toegang gaf tot de overblijfselen. Dit terwijl Jacob de beenderen niet zelf had gevonden. In Indonesië heeft de man als paleontoloog echter een enorme status. “Mijn collega’s en ik waren het er zeker niet mee eens dat de beenderen ‘geleend’ werden”,aldus Mike Morwood van de Universiteit van New England in het Australische New South Wales. Zijn collega Peter Brown is minder diplomatiek. “Geleend? Ze zijn gestolen of ontvoerd en vervolgens beschadigd”.Maar Jacob en Eckardt menen dat de oorspronkelijke onderzoekers belangrijke fouten hebben gemaakt. Ze stellen dat de beenderen alleen met de normale menselijke variant is vergeleken en niet met die van de Pygmee die het eiland daadwerkelijk bewoont.“Het is toch vreemd dat ze niet als eerste hebben gekeken naar de lokale bevolking“, stelt Eckhardt. Uitzonderlijke resultaten Een onafhankelijke studie van de Australische National University in Canberra komt echter weer tot een andere conclusie.Ze vergeleken de botten van Flores met botfragmenten van zowel mensen als Pygmeën en kwamen met uitzonderlijke resultaten naar buiten:”Het is onwaarschijnlijk dat de botresten behoren tot de soort  sapiens  , ze kunnen  zeker   ook  niet worden toegewezen tot een bij ons bekende  mensachtige soort”. Links:

2006 Planet Internet

HERSENEN 
Virtuele ENDOCAST  LB1
Australische onderzoekers stootten in september 2003 tijdens opgravingen in de Liang-Bua-grotten op het skelet van een volwassen hobbitvrouw. De smalle lichaamsbouw en de kleine schedel deden denken aan aapmensen (australopithecinen).
Onderzoek van schedel en kaakbeenderen toonde echter aan dat het ging om een ongewone mix van primitieve, moderne en eigen kenmerken.
Vooral de ge zichtstrekken en de tanden van het skelet wezen in de richting van een mensensoort van het geslacht Homo.
Homo floresiensis  was ondanks zijn kleine gestalte verrassend slim.  —>De wetenschappers vonden  verrassend afgevijlde werktuigen en sporen van een zelfgemaakt vuur in de buurt van de fossielresten. —> De hobbit zou volgens onderzoeker Dean Falk van de universiteit van Florida de zee hebben overgestoken om zich op het eiland Flores te vestigen.
De kleine ‘hobbit’ die tot 18.000 jaar geleden op het Indonesische eiland Flores leefde, was nauwelijks 1 meter groot. Het hoofd van de homo floresiensis was zo groot als een pompelmoes
Enkele kenmerken van de fossielen, zoals het schuine voorhoofd, brengt Dean  Falk in verbinding met de homo sapiens, de voorvader van de huidige mens (Homo sapiens sapiens).
De anatomische bijzonderheden duiden erop dat de hobbit sterke waarnemingskwaliteiten bezat.
De dwergmens had  slechts een derde van de hersenmassa van de moderne mens. Dat schrijven de onderzoekers in de online-editie van het wetenschappelijke magazine Science.( zie onderaan )
Ditzelde  internationaal onderzoeksteam beschrijft  dat de hersenstructuur van de kleine mensensoort leek op die van de rechtop lopende Homo erectus of op die van een minstens evenzeer ontwikkelde australopithecus.
Een driedimensionaal model van de structuur van de hersenen ( virtueel endocast )  toonde een duidelijke zwelling van de voorste hersenkwabben.
Volgens het onderzoeksteam zijn er twee conclusies mogelijk. —>Ofwel is de hobbit nauw verwant met de Homo erectus en ontwikkelde hij zijn dwerggestalte door de voedselschaarste op het eiland, —->ofwel bestond er een tot nog toe onbekende voorvader van de Homo erectus en de Homo floresiensisdie een kleiner lichaam en kleinere hersenen bezat.

ABSTRACT  Science magazine  Published online 3 March 2005
Submitted on January 13, 2005 Accepted on February 11, 2005
The Brain of LB1, Homo floresiensis Dean Falk 1*, Charles Hildebolt 2, Kirk Smith 2, Mike J. Morwood 3, Thomas Sutikna 4, Peter Brown 3, Jatmiko 4, E. Wayhu Saptomo 4, Barry Brunsden 2, Fred Prior 2 1 Department of Anthropology, Florida State University, Tallahassee, FL 32306, USA. 2 Mallinckrodt Institute of Radiology, Washington University School of Medicine, St. Louis, MO 63110, USA. 3 Archaeology & Palaeoanthropology, University of New England, Armidale, New South Wales 2351, Australia. 4 Indonesian Centre for Archaeology, JI. Raya Condet Pejaten No. 4, Jakarta 12001, Indonesia.
* To whom correspondence should be addressed. Dean Falk , E-mail: dfalk@fsu.edu
The brain of Homo floresiensis is assessed by comparing a virtual endocast from the type specimen (LB1) with endocasts from great apes, Homo erectus, Homo sapiens, a human pygmy, a human microcephalic, Sts 5 (Australopithecus africanus) and WT 17000 (Paranthropus aeithiopicus).
Morphometric , allometric and shape data indicate that LB1 is not a microcephalic or pygmy.
LB1’s brain size versus body size scales like an australopithecine, but its endocast shape resembles that of Homo erectus.
LB1 has derived frontal and temporal lobes and a lunate sulcus in a derived position, which are consistent with capabilities for higher cognitive  processing.
HOMO SULAWESI ?
January 29, 2007  Carl Zimmer
(The picture above shows a reconstruction of one microcephalic on the left and Homo floresiensis on the right.) Now comes the new paper from Falk. In it, she and her colleagues compare nine microcephalic brains and a dozen normal human ones. The scientists identified some key traits that they could use to classify brains as normal or microcephalic with complete accuracy. Although microcephalics do vary a lot in some ways, the researchers found that their cerebellum (a lump in the back of the brain important for motor control) protrudes and bulges a lot compared to a normal cerebellum. They also have narrow, flattened orbital lobes. According to this standard, Homo floresiensis is not a microcephalic. (The paper is not online yet, but when it goes up, this link will work: http://www.pnas.org/cgi/doi/10.1073/pnas.0609185104 Heropening hobbitgrot

Zimmer ;  “Could 2007 see some new hobbits? I certainly hope so.” De grot waar de resten van de Floresmens zijn gevonden, het minimensje waarover al jaren geruzied wordt, wordt weer geopend voor opgravingen, meldt de BBC. Sluit dit venster Liang Bua, de grot waar de eerste resten van de Floresmens werden opgediept. (Foto Michael Morwood)  Het kamp van de ontdekkers blijft volhouden dat Homo floresiensis beslist een aparte mensensoort was, die nog maar een jaar of twaalfduizend is uitgestorven. Critici zeggen met al evenveel stelligheid te hebben aangetoond dat het enige opgegraven schedeltje afkomstig is van een moderne mens die leed aan een ontwikkelingsstoornis. Beide kampen bestoken elkaar al jaren met publicaties in vaktijdschriften en schimpscheuten in de media. Dé manier om een einde aan de loopgravenoorlog te maken is natuurlijk het vinden van meer schedels op dezelfde plaats. Dat ging de afgelopen jaren niet, omdat de Indonesische overheid de Liang Bua-grot tot verboden gebied had verklaard. Maar het tij is gekeerd. Richard Roberts, één van de vinders van de hobbitschedel, zei dat gisteren tegen de nieuwsdienst van de BBC. Er mag weer gegraven worden: “We zijn erin geslaagd om alle politieke obstakels te slechten. Het is nu zaak om alles te organiseren.” Roberts en zijn groep moeten nog wel even geduld hebben, want het is nu regentijd, en dan is het te nat om naar de grot te rijden en er diepe gaten in te graven http://noorderlicht.vpro.nl/noorderlog/ http://noorderlicht.vpro.nl/noorderlog/#item32951909(  met  link naar  audio file ) http://noorderlicht.vpro.nl/artikelen/29709382/

Nieuwe aanval op de hobbit

http://noorderlicht.vpro.nl/artikelen/39333793/

Eindelijk een passende ziekte voor de dwerg van Flores?

Zijn de fossiele botten die in 2003 op het Indonesische eiland Flores zijn gevonden dan toch van zieke moderne mensen? Australische onderzoekers menen dat een combinatie van jodiumgebrek en vergiftiging met cyanide alle afwijkingen kan verklaren. Niks aparte soort dus. Maar er klinkt meteen veel kritiek. ____________________________________________________intermezzo ————————————————————– Sluit dit venster De ‘endocast’ (hersenafdruk) van Homo floresiensis, afgeleid uit CT-scans en rood ingekleurd.  http://www.corante.com/loom/archives/hobbit%20brain.gif http://www.corante.com/loom/archives/2005/03/03/the_hobbits_brain.php http://erl.wustl.edu/research/imseg/hobbit.html

GEEN MICROCEFAAL 
Het  document ( falk et al ) geeft  heel wat gegevens over de verhoudingen van  de diverse afmetingen van de vergelijkingen  tussen verschillende types  hersenen  bij  homo  , die(in grote trekken) aantonen :
” hoe  sterk pathologisch de microcefale hersenen  wel zijn, en hoe vrij normaal de  H. floresiensis hersenen  er uitzien 
Uiteindelijk  blijkt de  microcefaal-hypothese , op het huidige ogenblik , niet meer houdbaar
Maar de hoofdbrok van het artikel/rapport   is wel  de Vergelijkingen  tussen de virtuele endocast van het Homo floresiensis specimen ( midden ) ,  met H. sapiens (  boven de floresensies endocast  ) ,  een chimpansee (onder) ,een microcefaal  (links), en H.  erectus ( rechts) ,
Dat  is  een  redelijk overtuigende ondersteuning   voor de stelling  dat de hobbit geen  ( pathologische ) microcefaal is : maar een hominide in het bezit van een klein maar normaal brein
( zoals gepubliceerd door Dean Falk in science
Falk et al., The Brain of LB1, Homo floresiensis, Science 2005 0: 11097271
en uitgebreid  gerapporteerd/bekommentarieerd  door CarlZimmer
hobbit brain.gif

hf-brain-scans-fronthf-brain-scans-left

Omdat ie echt afsteekt bij de rest  van het vergelijkingsmateriaal lijkt iets zinnig afleiden uit deze  gietvorm van de gebruikte  microcefaal   onbegonnen werk …
Misschien is de gladheid van deze microcefale  endocast relevant, of is dat enkel een artefact van het afgietsel/scanning proces?
Volgens het rapport dus niet ;
” …. De hersenen van de  Hobbit lijken helemaal niet op  de hersenen van  de microcefaal . De  Microcefaal  heeft gladde  hersenen, bijvoorbeeld; De Hobbit heeft een normale oppervlakte met veel hersensulci , plooien  en rimpels . Bovendien  hebben  microcefale  hersenen hebben een gerichte bovenkant en een hellend voorhoofd; de hersenen  van de Hobbit zijn bovenaan  rond gemaakt  en hellen niet af  vooraan… “
Het rapport geeft ook nog hele  reeksen  tabellen met  verschillende waarden  voor  diverse parameters in verband met relatieve hersenenafmetingen ( isometrie ): florensensies past in alle geval niet in het microcefaal pathologische patroon dat men volgens die metingen  kan verwachten /extrapoleren
De  ( erg kleine ) hersenen van  de  LB1  H. floresiensis  endocast ,  zien er overwegend ” normaal”  uit
Het zijn echter  geen “normale” hersenen, in de betekenis van : “het zijn  miniatuur sapiens hersenen ” ; de hersenen zijn   normaal in de betekenis  van “ze zijn niet  duidelijk pathologisch  en daarom ( verondersteld )  “normale”(?)  floresiensis hersenen ” .
 Dat  is voorlopig  het  beste wat  wij  tot nu toe kunnen  vertellen.Verdere  vondsten  zijn  dringend nodig … Immers normaal is een  ander woord voor ” statistisch  meest voorkomend 
Maciej Henneberg ( de voortrekker vann de microcefaal verklaring ) zegt nu, echter, dat Falk et al  de hobbit  hebben vergeleken met  een verschillend type van microcefaal dan  het type dat hij heeft gebruikt .
Het is waar dat er verschillende types microcefalen  zijn, zodat dit dus wel degelijk een ( theoretische ) mogelijkheid blijft; ___ alhoewel Men heeft  immers nog niet aangetoond dat dit andere type van microcefaal ( van henneberg )  om het even welke speciale gelijkenis met de  hobbit -endocast vertoont . Een aantal wetenschappers___ die het henneberg  rapport/ materiaal   over de  Kretenzische microcefaal  hebben bekeken ____ zijn van mening  dat er geen nauwe  gelijkenis met de  hobbit aanwezig is ;
Enkelen voorspellen dat (Waarschijnlijk ) ook een aantal  scans  en  dito virtuele endocast van dit type  microcefaal  geen dwingende gelijkenis met de hobbit LB1 endocast  zal vertonen (laat staan aannemelijk maken ?) .
Falk doet wat vrij veel , grondig en  goed  analyserend werk.
Het lijkt erop  dat de mensen die de microcefalie oplossing  willen blijven ter diskussie stellen als oplossing , hun beste tijd hebben gehad  Microcefalie is vrij zeldzaam in het archeologische verslag. Eisen dat een  nog  zeldzamere vorm dan diegene die falk overwoog nog roet in het eten kan gooien , is een strohalm  . De bewijslast ligt nu volledig in het kamp van deze microcefaal- proponenten  .

http://pharyngula.org/index/weblog/comments/homo_floresiensiss_brainigor_didnt_screw_up/ http://www.corante.com/loom/archives/2005/03/03/the_hobbits_brain.php Right frontal view with red brain cast of LB1 encased in transparent image of LB1’s skull. (Credit: Photo courtesy of Washington University in St. Louis) http://www.sciencedaily.com/releases/2005/03/050304175249.htm http://www.andaman.org/BOOK/chapter49/text49.htm

Het volgende is voorgesteld ; ( korte versie )

…. the brain of the hobbit most closely resembles that of Homo erectus and does not look like the brain of a microcephalic, but it does have its own peculiarities. …

zie voor alle details en meerdere links     http://www.corante.com/loom/

Follow up I
Uit de  gedetailleerde vergelijkingen van de schedels van LB1, andere homininden   en chimpansees  kan worden geconcludeerd dat  de gevonden Homo Floresiensis geen toevallige microcephaal is , maar in plaats daarvan een verschillende — en nu uitgestorven —  hominide soort is.
“De  schedel van een echte   microcephaal  die we in deze studie  gebruikten  , heeft een   vorm die in  niets aan de  fossieke LB1 herinnerd …” 
 zei studie mede-auteur Charles Hildebolt, een professor radiologie en antropologie van  de Universiteit  van Washington . Hij en zijn mede-onderzoekers — die de wetenschappers omvat die LB1 vonden — geloven,  meer dan ooit, dat Homo Floresiensis een  afzonderlijke soort is .
Niet  iedereen  ging er toen  mee akkoord.
Andrew Kramer antropoloog aan  de Universiteit van Tennessee die zich in Homo erectus specialiseert, _____ een andere hominide die  een eeuw geleden werd  gevonden op  het Indonesische Eiland Java ( pithecantropus erectus -van Dubois  ( trinil  .)  is  nooit een aanhanger van de  de microcephaal uitleg  geweest ,
maar ,  zei hij
 neigde meer naar de idee  dat  LB1  een  pygmee-ras  is van de  plaatselijke  zuid-oost aziatische  Homo erectus, en niet een unieke of aparte  soort dus , maar slechts een dwergvorm van erectus . “Ik meende altijd erg  veel geliikenissen  met een  erectus-schedel, te kunnen konstateren  En de [ virtuele  endocast  ) analyse  in deze studie ,  verstrekt opnieuw  mijn standpunt .”
In hun studie, deden  Hildebolt en zijn collega’s uitgebreide en  gedetailleerde metingen van de LB1 schedel,  evenals aan de  schedels van  hedendaagse  Homo sap ; een recente (nu uitgestorven) verwant van  homo  erectus ; een menselijke pygmee; een microcephale  mens; en twee veel oudere voorvaderen van moderne mensen,
Australopithecus africanus en Paranthropus aethiopicus .
Tijdens de levensloop  zetten ,  zich  ontwikkelende hersenen  blijvende subtiele indrukken op de binnenkant van de schedel af , Het team van Hildeboltgebruikte  hi-tech technologieën  om virtuele 3-D “endocasts” te konstrueren van wat de  hersenen  van elk van deze verschillende  specima  waarschijnlijk ooit waren …
 De “gelijkenissen tussen de LB1 endocast en  die van de  homo erectus ,en  vertrekkend bij  de voorouderlijke apen, of  australopithecine- vorm van de hersenen, tonen een toenemende  reorganisatie van de hersenen in een menselijke richting ; 
De hersenen van de ” hobbit”  verschilden  boovendien  ook vrij veel  van die van  de microcephale  mens of de sapiens   pygmeeën,
SULCUS  LUNATUS

Het belangrijkste  kenmerk  betreft   de sulcus lunatus, — een diepe groef die in primaten en menselijke hersenen wordt gevonden   en die in de frontale  hersenen   de hersenmassa  in  kwabben  verdeeld

Volgens Hildebolt= komt  bij ”  apen de sulcus lunatus, ,  in vergelijking  met   LB1 — en  zoals in  moderne mensen — dichter naar  de  voorzijde van de schedel voor,


 de groef schuift in de loop van de evolutie  op naar achteren  ” “de kwabben, liggend aan de beide  kanten van de sulcus ; worden vergroot in LB1, en worden meer  gelijkend op  die welke je  in menselijke hersenen vind ….  In [ moderne ] mensen, wordt  deze nieuwe positie  verondersteld  de  uitdrukking te zijn  van een verbetering ( optimalisatie )  van de  cognitieve functies, (en hun  connecties met ) het  spraak en  gehoorcentrum   “
De hersenen van LB1 schijnen  ook diepe, complexe windingen, te bezitten :  een andere indicator van menselijke-hersenenontwikkeling,
Opvallend is ook de aanwezigheid  van het gebied 10 van  Brodmann , gesitueerd   rechtvooraan  de frontale kwab Dat gebied is bij   mensen aktief  bij  het ondernemen van initiatieven en de planning van toekomstige acties.”

 File:Brodmann area 10.png   Brodmann Cytoarchitectonics 10.png Brodmann area 10, or BA10, is part of the frontal cortex in the human brain. BA10 encompasses the most anterior part of the frontal cortex, known as the frontopolar region. This area is believed to play a part in strategic processes involved in memory retrieval and executive function. http://neurolex.org/wiki/Birnlex_1741

Elk van deze kenmerken  wijst op een  verhoogde intelligentie, en  stelt de wetenschap voor één groot raadsel:
 Hoe,vragen de deskundigen zich af , kon een  slimme Homo Floresiensis — gelet op de archeologische  aanwijzingen voor vuur en werktuiggebruik en fabricage  ____ genoeg hebben  met  hersenen die  slechts één derde  van het  sap hersenvolume  voorstellen ?
Een  vraag  waar iedereen  graag het antwoord op wil weten ,” Het is een grote moeilijkheid vanuit  het standpunt van de paleantropologie wij altijd hebben gedacht dat  grotere hersenen  kwalitatief beter zijn.”
“Er zijn ook nog  andere vragen,  — hoe  kwam Homo Floresiensis op het eiland  Flores terecht?  — per  boot?”
Hildebolt wijst  erop dat, zelfs tijdens het laag-waterstand  van de laatste Ijstijd, het eiland van andere eilanden en  het vasteland gescheiden  bleef ,  door minstens 12 mijlen  diep zeewater .
Kramer vecht  aan dat LB1 een verschillende soort is  dan  homo   Erectus. “het is   mogelijk  dat de gebrande beenderen en de ruwe hulpmiddelen  die werden gevonden  in de buurt van LB1 door  moderne mensen zouden kunnen zijn  gemaakt  toen die het eiland bereikten en  uiteindelijke  ook het uitsterven  van Homo Floresiensishebben veroorzaakt .”
” zijn  deze artefacten  echter wel het produkt van de met een  kleine hersenmassa uitgeruste  homo floresiensis  “ dan is dat een  serieuse uitdaging  voor de  neuro-evolutieve theorie
“Wat dit zou kunnen illustreren  dat het niet noodzakelijk de grootte van de hersenen is die belangrijk is[ voor intelligentie ], maar eerder de verbindingen, en  de manier  waarop de hersenen worden gestructureerd en ontwikkeld ,”
Niemand weet precies waarom Homo Floresiensis  ongeveer 13.000 jaar geleden uitstierf.
Toen  zij  nog in Flores woonden, schijnen LB1 en haar soortgenoten  op Stegadon, een nu-uitgestorven vorm van dwergolifant  gejaagd te hebben. Volgens het team dat LB1 vond, werd  in het gebied waar zij werd gevonden  ook  een  hoop  rommelige  afval   met beenderen van kleinere, juveniele stegadons, gevonden ;  die  waren  gemakkelijker door de uiterst kleine hobbitjagers te verschalken .
Ondertussen, zijn er  geruchten  dat het team dat LB1 vond , nog  meer van haar lotgenoten  heeft gevonden ( ondermeer een onderkaak van een tweede individu )
het ” argument achter het idee dat Homo floresiensis  één of andere soort van ‘ pathologische pygmee ‘ is , is gebaseerd op het feit dat daar slechts één individu, één specimen,is gevonden ” “Als er dus  meer materiaal vanuit  die zelfde lagen  en van  duidelijk verschillende individuen van Homo Floresiensis zijn ( worden )  gevonden , dan wordt  het moeilijk  om dat argument  te blijven vol houden.”
Maar waarschijnlijk zal Tekeu Jacobs  alle “nieuwe vondsten”( en de oudere )  opeisen en( voor een tijdje )  opsluiten in zijn brandkast 
De onderzoekers menen echter dat er een redelijke kans bestaat nog andere  vergelijkbare  “soorten”   homo  te vinden op de verschillende eilanden ( en het  Maleisia schiereiland  )in Zuid-oost azie ….En zullen ze ___wijzer geworden
___ Tekeu Jacobs niet gauw meer de kans geven om  nieuwe  vondsten   in indonesia voortijdig  aan te slaan  en weg te stoppen …
Meer informatie over   de stamboom  van de menselijke familie Smithsonian  http://articles.health.msn.com/id/100100952?GT1=6203

______________________________________________________________________________________________________ Sluit dit venster Een grote rol in het betoog van de onderzoekers is weggelegd voor de meneer rechts, die destijds (in 1971) 21 jaar oud was en 1.17 meter mat. Hij leefde op het eiland Idjwi, Congo. Let ook op zijn bijzondere onderkaak, met nauwelijks een kin.   Sluit dit venster Een foto uit het proefschrift van de Nederlander L.B. van Bommel (1930), waarop een 27-jarige doofstomme vrouw met haar pleegmoeder te zien is. Van Bommel wees jodiumgebrek aan als oorzaak van de afwijkingen.  Direct nadat Homo floresiensis aan de wereld werd gepresenteerd, in oktober 2004, werd die ontdekking betwist. De ontdekkers meenden dat de botten die ze het jaar daarvoor in een grot op het eiland Flores hadden gevonden, van een tot dan toe onbekende soort dwergmens waren, die tot twaalfduizend jaar geleden op Flores moest hebben geleefd. Maar critici deden de botten af als overblijfselen van gewone mensen met aangeboren afwijkingen. De ontwikkelingsstoornis microcefalie (‘kleinhoofdigheid’) zou de bijzonder kleine schedelinhoud en de kleine afmetingen van deze ‘hobbit’ kunnen verklaren, betoogden zij. Maar die theorie werd met goede argumenten tegengesproken. De vorm van de enige gevonden schedel lijkt niet op die van een microcefaal en ook andere botten pasten eerder bij primitieve menssoorten dan bij de moderne mens. Dat de hobbit in werkelijkheid een microcefaaltje was, wordt onder paleontologen dus niet meer zo waarschijnlijk geacht. Maar nu duikt er een nieuwe theorie op. Drie Australische wetenschappers leggen in het wetenschappelijke tijdschrift Proceedings of the Royal Society B uit waarom zij het waarschijnlijk achten dat een andere aangeboren afwijking de verklaring is voor de alle rare kenmerken van de botten. Aangeboren, maar niet erfelijk. Het zou gaan om ‘myxoedemateus endemisch cretinisme’, vrij vertaald: een veel onder de plaatselijke bevolking voorkomende vorm van dwerggroei en achterlijkheid, veroorzaakt door een niet werkende schildklier. Dat zou op zijn beurt het gevolg zijn van een combinatie van jodiumgebrek, seleniumgebrek en een overmaat aan het plantengif thiocyanaat, opperen Peter Obendorf, Charles Oxnard en Ben Kefford. In hun artikel vergelijken ze de kenmerken van LB1, het meest complete hobbitskelet, met beschreven gevallen van dit cretinisme. Zelf hebben ze geen bot aangeraakt bij die vergelijkingen; het was allemaal papierwerk, deels op basis van foto’s. Ze beginnen bij de lengte. De hobbit zou net iets langer dan een meter zijn geweest. Cretinisme zorgt meestal voor een lichaam dat ongeveer 70 procent van de normale lengte heeft. Aangezien de lokale bevolking op Flores gemiddeld ongeveer 1 meter 60 meet, klopt dat goed. Dan de schedel. Die van LB1 is asymmetrisch, de neuswortel is extra breed, de kin ontbreekt, de tanden zijn relatief groot en sommige zijn vreemd van vorm. Dat zijn allemaal verschijnselen die voorkomen bij lijders aan cretinisme. Hun tanden groeien, in tegenstelling tot hun lichaam, wel normaal en zijn daarom relatief groot. Vaak verliezen deze kleine mensen niet al hun melktanden. De vreemde tanden van de hobbit kunnen heel goed melktanden zijn, menen de onderzoekers. Een belangrijk onderscheidend kenmerk van de hobbit was natuurlijk ook zijn kleine brein, niet meer dan 417 milliliter groot, terwijl een normaal mens minstens een liter hersenen heeft. Cretinisme zorgt voor kleine breinen, maar zo klein waren ze nog niet gezien. Dat zou deels kunnen komen doordat de plaatselijke bevolking vrij kleine hersenen heeft, opperen de onderzoekers, en deels doordat de schedelplaten lijders aan cretinisme meestal niet aan elkaar gegroeid zijn. Na de dood van de vermeende hobbit zouden ze alsnog tegen elkaar aangedrukt kunnen zijn, met een kleinere inhoud als gevolg. En de rest van het lichaam? Ook daar sluiten de observaties goed aan bij de nieuwe theorie, aldus het drietal Australiërs. Cretinisme levert relatief lange armen op, die minder bewegingsvrijheid hebben. Wederom: net als bij de hobbit, zij het minder extreem. Maar of het ook tot afwijkende polsbotjes leidt, is onbekend. Het zou sterk voor deze theorie pleiten als de polsbotjes van cretinismelijders dezelfde vorm zouden blijken te hebben als de opgegraven botjes uit de grot op Flores. Maar die polsbotjes zijn er niet. En dan nog de oorzaak, gebrek aan jodium en selenium plus een teveel aan thiocyanaat uit planten. Jodiumgebrek komt op Flores en nabije eilanden veel voor, lokaal geraapte kippeneieren vertonen een tekort aan selenium en er groeien eetbare planten die cyanide bevatten, schrijven Obendorf en zijn collega’s. Alles bij elkaar concluderen ze dat het niet bewezen is, maar wel waarschijnlijk, dat de gevonden ‘hobbitbotten’ in werkelijkheid overblijfselen zijn van zieke moderne mensen. Gemeenschappen van jagers-verzamelaars kunnen zulke gehandicapte stamgenoten niet goed onderhouden, daarom zou het best kunnen dat die op zichzelf hebben geleefd in de Liang Bua-grot waar hun botten gevonden zijn. “Een interessante hypothese”, vindt paleontoloog Gert van den Bergh het, maar niet meer dan dat. Van den Bergh was zelf betrokken bij de opgravingen in de Liang Bua-grot en vertrekt komende zaterdag weer naar Indonesië voor meer graafwerk. Voorlopig laat hij zich niet door de Australiërs overtuigen. Hij wijst erop dat de onderzoekers niet naar het originele hobbitmateriaal hebben gekeken en geen polsbotjes hebben kunnen vergelijken. “Bovendien zijn niet alle resten van Homo floresiensis even oud. De jongste zijn van twaalfduizend jaar geleden, de oudste van 95 duizend. Het zou wel heel toevallig zijn als er steeds weer mensen met hetzelfde syndroom in die grot terechtkomen.” En dan zijn er nog de stenen werktuigen. “Op Flores liepen 840 duizend jaar geleden al mensachtigen rond, bewijzen die. Lang voor de moderne mens ontstond. Bij de hobbitresten vonden we werktuigen van twaalfduizend jaar oud die op dezelfde manier gemaakt zijn.” Komt er dan nooit een einde aan het welles-nietesdebat rond de kleine mensjes? “Heb nog een beetje geduld”, zegt Van den Bergh.  Deze zomer is er weer een opgraving in de grot, en daarbij zal het er heel zorgvuldig aan toe gaan. Hopelijk levert dat DNA op, en dat zou het verlossende woord kunnen geven. We hebben op die plek al wel varkens-DNA weten te isoleren van zevenduizend jaar oud, dus wie weet. Elmar Veerman Peter J. Obendorf, Charles E. Oxnard en Ben J. Kefford: ‘Are the small human-like fossils found on Flores human endemic cretins?‘, Proceedings of the Royal Society B, 5 maart 2008 Experts slam the cretin hypothesis Matt Tocheri of the Smithsonian Institution, who published a paper in the journal Science last year describing LB1’s wrist bones. His findings are considered by some researchers to be among the strongest evidence yet that the hobbits were a species distinct from our own. He had this to say about the authors’ assertion that the hobbit wrist–in particular, the trapezoid bone–supports the cretinism claim: “In the paper we published in Science, we provided the descriptive, developmental, and quantitative details that demonstrate that pathological disturbances do not turn a human wrist (normal or pathological) into that of a chimpanzee or gorilla. We also provided the comparative evidence that demonstrates that early hominins (including LB1) retain wrist morphology inherited from the Pan-Homo last common ancestor, whereas Neandertals and modern humans share derived wrist morphology most likely inherited from their last common ancestor. The speculation that LB1 has a bipartite trapezoid is falsified by looking at the figures we published in Science. A bipartite human trapezoid would have half of all the trapezoidal articular surfaces missing while the scaphoid and capitate would show the articular areas of the missing half; but they do not, and all three bones articulate with one another fully (just like in an African ape). Moreover, cretin skeletons may sometimes show a bipartite scaphoid as the new paper contends (this is because of how the scaphoid tubercle ossifies) but LB1 does not have a bipartite scaphoid and is otherwise normal (as are the capitate and trapezoid) but normal for an African ape or primitive hominin. 60 or so million years of primate evolution provide the world with a considerably large amount of evidence that the wrist of modern humans and Neandertals is a recent acquisition in our shared evolutionary history. Moreover, the evidence indicates this acquisiton occured after the hobbits split from our hominin family tree. New hypotheses of hobbit pathology arise every week, and they will continue to disappear just as quickly afterward. The phylogenetic evidence of the wrist is just not that easy to explain away.” http://science-community.sciam.com/blog-entry/Sciam-Observations/Hobbit-Watch-Experts-Slam-Cretin/300010210

FLORESMENS HAD RELATIEF GROTE FRONTALE CORTEX  3 april 2009 /Hendrik Spiering . Homo floresiensis, de kleine mensachtige die tot 18.000 jaar geleden op het eiland Flores leefde, baarde bij zijn ontdekkig in 2004 veel opzien met zijn voor mensen extreem kleine schedelinhoud: 417 cc, net zoveel als een chimpansee. Homo sapiens heeft 1250 cc. Uit een CT-scan van de enig bekende schedel van deze ‘hobbit’ blijkt nu dat H. floresiensis opvallende (relatieve) vergrotingen heeft van belangrijke delen van zijn brein. Het gaat daarbij vooral om delen van zijn frontale cortex (de frontopolaire en orbitofrontale cortex), die belangrijk zijn voor planning en reflectie (Journal of Human Evolution, articles in press). HOE HOMO FLORESIENSIS ERUIT HEEFT KUNNEN ZIEN Volgens de onderzoekers heeft de studie ook belangrijke consequenties voor het belang dat altijd aan hersengrootte wordt gehecht in de analyses van de menselijke evolutie. Neurale reorganisatie en vormveranderingen kunnen even belangrijk zijn voor mentale kracht. Waarschijnlijk stamt de Floresmens af van Homo erectus (herseninhoud ca. 900 cc) en werd kleiner tijdens het bestaan op het afgelegen eiland Flores. Volgens de onderzoekers onder leiding van Dean Falk uit Florida maken deze en andere kenmerken duidelijk dat het brein van de Floresmens in zijn (evolutionaire) verkleining een grote reorganisatie heeft doorgemaakt. Het lijkt helemaal niet op even grote breinen van chimpansees of op die van moderne mensen met microcefalie (ziekelijk kleine hersenen). Die reorganisatie zou kunnen verklaren waarom de Floresmens toch in staat leek tot relatief modern gedrag: jacht op kleine olifanten op Flores en gebruik van geavanceerde stenen werktuigen. Direct na de bekendmaking van de vondst van de Floresmens rezen stemmen in de wetenschap dat het hier helemaal geen nieuwe mensensoort betrof maar slechts een treurig groepje moderne mensen met veel erfelijke afwijkingen, waarbij vooral microcefalie als ziektebeeld naar voren werd geschoven. Felle discussies volgden. Eerdere analyses van de schedel wezen al niet op microcefalie en het is niet onwaarschijnlijk dat deze studie een finale knak betekent voor de microcefalie-gedachte. Al zal het pas echt stil worden als een tweede Flores-schedel wordt gevonden. Met behulp van de geavanceerde CT-röntgentechniek is een gedetailleerd virtueel afgietsel van de binnenkant van de Floresschedel gemaakt waarmee een goed beeld kan worden gevormd van de hersenvormen. LB1’s virtual endocast, microcephaly, and hominin brain evolution

Received 18 January 2008;
accepted 30 October 2008.
online 28 February 2009.
Abstract  Earlier observations of the virtual endocast of LB1, the type specimen for Homo floresiensis, are reviewed, extended, and interpreted. Seven derived features of LB1’s cerebral cortex are detailed: a caudally-positioned occipital lobe, lack of a rostrally-located lunate sulcus, a caudally-expanded temporal lobe, advanced morphology of the lateral prefrontal cortex, shape of the rostral prefrontal cortex, enlarged gyri in the frontopolar region, and an expanded orbitofrontal cortex. These features indicate that LB1’s brain was globally reorganized despite its ape-sized cranial capacity (417 cm3). Neurological reorganization may
thus form the basis for the cognitive abilities attributed to H. floresiensis. Because of its tiny cranial capacity, some workers think that LB1 represents a Homo sapiens individual that was afflicted with microcephaly, or some other pathology, rather than a new species of hominin. We respond to concerns about our earlier study of microcephalics compared with normal individuals, and reaffirm that LB1 did not suffer from this pathology. The intense controversy about LB1 reflects an older continuing dispute about the relative evolutionary importance of brain size versus neurological reorganization. LB1 may help resolve this debate and illuminate constraints that governed hominin brain evolution.
Keywords: H. floresiensis; LB1; Microcephaly; Virtual endocast; Brain evolution; AustralopithecusParanthropus

MORFOLOGIE v/h polsgewricht     

HOMO FLORESIENSIS is toch nieuwe mensensoort ( Eos nieuwsbericht )
H. Floresiensis “Flo” http://www.bloggen.be/evodisku/archief.php?ID=28De Floresmens, door zijn kleine gestalte ook wel hobbit genoemd, vertegenwoordigt dan toch een nieuwe soort in het geslacht Homo. De acht skeletten die in 2003 in een grot op het Indonesische eiland Flores werden opgegraven, stelden de paleoantropologie voor een raadsel. De volwassen individuen zouden tussen 120.000 en 10.000 jaar geleden geleefd hebben en zouden sterk op de moderne mens (Homo sapiens) gelijken, alleen hadden ze een veel kleinere gestalte en schedelinhoud.De Homo floresiensis of populair ” hobbitâ”  zou volgens sommigen een nieuwe mensensoort vertegenwoordigen die zelfs nog een tijdje naast de moderne mens heeft bestaan. Anderen meenden dat de individuen gewoon een groepje fysiek ‘achtergestelde’ Homo sapiens waren.Maar uit nieuw onderzoek naar het polsgewricht van de Floresmens, concluderen onderzoekers nu dat het wel degelijk gaat om een nieuwe mensensoort in het geslacht Homo. De polsbeentjes zijn immers veel primitiever dan bij de moderne mens …..
250 px wrist

wrist x-ray
De handwortelbeendeeren van de modern mens (Image: iStockphoto)
Image Science
°

Een vergelijking van  wrist” bones(= handwortelbeenderen ) bij “hobbit”(links ) en een moderne mens:  suggereerde dat de dwergvorm een unieke species  is  ….. Het gaat om het handwortelbeen OS TRAPEZOIDEUM / Het klein Veelhoekig Been ( zie  http://www.memorizer.net/nl/menselijk_lichaam/skelet/botten_overzicht/?name=klein+veelhoekig+been  )250px-OS

nr . 11 uit een frans anatomie leerboek ( Trapèze (T))

250px-CarpusBONES OF HAND Proximal: A=Scaphoid, B=Lunate, C=Triquetral, D=Pisiform Distal: E=Trapezium, F=Trapezoid bone , G=Capitate, H=Hamate(allemaal aanklikbaar …)

http://www-sante.ujf-grenoble.fr/SANTE/hand/CHAPITRS/IMAGES/PICTURE

°Anatomie squelettique d’après F. Moutet    1. Radius 2.Cubitus 3.Articulation radio-cubitale inférieure 4. pisiforme (p) 5. Pyramidal (P) 6. Semi-Lunaire(L) 7. Scaphoïde (S)  8. Os Crochu (OC)9. Grand Os (GO)  10. trapézoïde (t) 11 .( Trapèze (T))12. Articulation Trapézo-Métacarpienne (TM)13. Articulations Carpo-Métacarpiennes (CMC)  14. Métacarpiens (M) 15. Sésamoïdes 16. Articulation métacarpophalangienne du pouce  17. Espaces interosseux 18. Articulation Interphalangienne du Pouce (IP)19. Articulations Métacarpophalangiennes (MCP)20. Articulations InterPhalangiennes Proximales (IPP)21. Articulations InterPhalangiennes Distales (IPD) Menselijk os trapezoideum

 

°

www.eskeletons.org/human/trapezium/tzml.jpg

ut UT logo

human trapezium

 

Taxon: Chimpanzee/Bone: Trapezium

View: Palmar ….Dorsal ……………Lateral

Taxon: Orangutan  /Bone: Trapezium

View:

Palmar  /………Dorsal/…………….Lateral

http://www.eskeletons.org/comparative.html


Science 21 September 2007: Vol. 317. no. 5845, pp. 1743 – 1745 DOI: 10.1126/science.1147143 REPORT

°

The Primitive Wrist of Homo floresiensis and Its Implications for Hominin Evolution

°

Matthew W. Tocheri,1* Caley M. Orr,2,3 Susan G. Larson,4 Thomas Sutikna,5 Jatmiko,5 E. Wahyu Saptomo,5 Rokus Awe Due,5 Tony Djubiantono,5 Michael J. Morwood,6 William L. Jungers4

°

Whether the Late Pleistocene hominin fossils from Flores, Indonesia,represent a new species, Homo floresiensis, or pathologicalmodern humans has been debated. Analysis of three wrist bonesfrom the holotype specimen (LB1) shows that it retains wristmorphology that is primitive for the African ape-human clade.In contrast, Neandertals and modern humans share derived wristmorphology that forms during embryogenesis, which diminishesthe probability that pathology could result in the normal primitivestate. This evidence indicates that LB1 is not a modern humanwith an undiagnosed pathology or growth defect; rather, it representsa species descended from a hominin ancestor that branched offbefore the origin of the clade that includes modern humans,Neandertals, and their last common ancestor.

°

1 Human Origins Program, Department of Anthropology, National Museum of Natural History, Smithsonian Institution, Washington, DC 20013, USA. 2 School of Human Evolution and Social Change, Arizona State University, AZ 85287, USA. 3 Institute of Human Origins, Arizona State University, AZ 85287, USA. 4 Department of Anatomical Sciences, School of Medicine, Stony Brook University, NY 11794, USA. 5 The National Research and Development Centre for Archaeology, Jakarta, Indonesia. 6 School of Earth and Environmental Sciences, University of Wollongong, NSW 2522, Australia. * To whom correspondence should be addressed. E-mail: tocherim@si.edu type=text/javascript>

 

°

( samenvattende vertaling van het National Geographics artikel )

°

De handwortelbeenderen van de homo florensiensis lijken in niets op die van de handwortelbeenderen van om het even welke moderne mensen ook , noch op die van Neanderthalers” zei Matthew Tocheri, een paleoanthropoloog van het Smithsonian in Washington, D.C.

De pols van H floresiensis mist moderne eigenschappen die wel bij sapiens en neanderthaler aanwezig zijn ; bijvoorbeeld een polsgewricht dat druk op het beginpunt van de duim afleidt en verspreidt over het hele gewricht zodat schokken beter kunnen worden opgevangen.

°

De pols van de Hobbit laat niet diezelfde specialisatie zien, bedoeld voor het gebruik van gereedschap, als de moderne mens of de Neanderthaler,zei Matthew Tocheri.

°

Het heeft dezelfde primitieve morfologie als  eerdere hominiden

” De florensies polsbeenderen zijn primitief,” zei hij, “ net als die van gorilla’s, chimpansees, en andere fossiele vroege menselijke verwanten en voorouders .”

Dit wijst erop dat de hand van de hobbit- stamlijn voo r de moderne geëvolueerde handwortelbeenderen verscheen.

“Dit is fundamenteel iets dat afkomstig is van een voorvouderlijke afsplitsing die waarschijnlijk ergens tussen één a drie miljoen jaar geleden plaatsgreep ….Wie die voorvader is moet wachten tot de polsbeenderen van andere fossielen worden gevonden ….. De mogelijkheden zijn de H erectus en de meer primitieve australopithecines. ”

Vooraleer de hobbit-studie uit te voeren , had Tocheri al vastgesteld dat de trapezoide wigvormig is bij de grote mensapen en de vroege menselijke hominida , terwijl het meer vierkantig is gevormd bij moderne mensen en Neandertalers -handen .

°

Dat bepaalde handwortelbeen in de hobbit-hand behoudt de wigvorm ….Het was niet moeilijk om vanuit die anatomische kennis te concluderen dat de hobbit een eigen unieke soort is. Chris Stringer antropoloog bij het Museum van de Biologie in Londen zei dat de studie overtuigend aantoont dat de “wrist-bones ” van de hobbit primitief zijn. Het onderzoek ondersteunt ook vorige studies die primitieve schouderverbindingen , het kaakbeen van de hobbit, evenals ongepubliceerde rapporten van primitieve eigenschappen in de floresiensis – voet, ontdekten .

“Wanneer men dit alles samenbrengt, wordt het idee versterkt dat dit inderdaad een zeer vreemd en zeer primitief soort schepsel moet zijn geweest …. Zelfs niet noodzakelijk behorend tot deHomo ….Het is duidelijk, dat we nog meer fossiel materiaal nodig hebben nodig hebben ”

°

Robert Martin is curator voor biologische antropologie van het Museum van Chicago en mede-auteur van twee documenten die stellen dat de hobbit een zieke moderne mens , is . Hij zei dat die mogelijkheid ondanks de nieuwe bevindingen overeind blijft.

°

Terwijl de de hand-beenderen van de Hobbit primitief lijken, geeft de studie geen enkele directe vergelijking van de hand van de hobbit met die van een moderne mens met microcefalie.

°

Derhalve blijft hij geloven dat Microcefalie de oorzaak is van die

“wanordelijke beenderen-abnormaliteit “ die de hobbit treft.

Dat is ook de oorzaak van misvormingen elders in het skelet, potentieel zelfs de hand .

“ik houd me aan de suggestie die eerder al de hobbit beschreef als een pathologische moderne mens ipv een niewe hominidesoort”

Echter : Tocheri en collega’s schrijven in hun artikel wèl dat ; geen bekende genetische ziekte, met inbegrip van microcefalie, in een hand resulteert die zowel op die van de hobbit of die van andere vroege menselijke voorvaderen , lijkt.

°

Niettemin, blijft het geheim van wat precies hobbit is en hoe het op het Eiland Flores verzeild raakte , onopgelost. De onderzoekers moeten op zoek naar de nog niet beschikbare polsbeenderen van homo erectus en bepalen in ;hoeverre de moderne handmorfologie bij de dichtste directe voorvader van de moderne mens aanwezig was.

°

Dergelijke informatie zal helpen verduidelijken of hobbit een homo erectus is die gekrompen is om zich aan te passen aan de mogelijkheden van het geïsoleerde Indonesische eiland , daadwerkelijk een nieuwe soort is.

Het “feit dat handwortelbeenderen zo duidelijk naar de mens-aapmorfologie richt is vrij interessant,” zei Campbell Rolian, een postdoctoraal student antropologie van de Universiteit van Harvard. “En [ het ] is in werkelijkheid een nieuw argument voor hen die bereid zijn om het aan een nieuwe soort toe te schrijven.” zie ook http://www.sesha.net/edEN/nieuws/2007-18.asp

De nieuwe studie neigt er dus alweer naar om te verondrstellen dat ;

* De evolutielijn van de hobbit splitste zich al vroeger af van die van de Homo sapiens sapiens . ( en van de homo sapiens Neanderthalensis )

* Sommigen menen dat de flores- mens een afstammeling is van een vroege homo erectus ( = consensus ) of zelfs de Homo ergaster of habillis ( sommigen veronderstellen een late australopithecus / Georgicus = dmanisi

 

zie ook : Homo floresiensis ( engelse wikki ) http://www.abc.net.au/science/news/stories/2007/2038346.htmhttp://www.bradshawfoundation.com/floresiensis.php2007[youtube=http://www.youtube.com/watch?[youtube=http://www.youtube.com/watch?More information Colin Grove’s work can be found here:http://arts.anu.edu.au/grovco/ & here: http://arts.anu.edu.au/AandA/people/shttp://www.pandasthumb.org/archives/2007/06/the_hobbit_on_d.html#moreINTERMEZZO 

 °

Dwergbotten gevonden op Palau

11 maart 2008 –

°

Op het Micronesische eiland Palau zijn fossiele botten gevonden van extreem kleine mensen. Volgens de ontdekker, een Zuid-Afrikaanse antropoloog, zijn ze het product van ‘verdwerging’.

 
Comparison of the two innominates from Palau to that of a modern adult female of average stature (c162 cm). From left to right — modern human pelvis (top is from the right, bottom is from the left), B:OR-15:18-009 and B:OR-15:18-087. Top: posterolateral view; bottom: lateral view. (Credit: Berger LR, Churchill SE, De Klerk B, Quinn RL (2008) Small-Bodied Humans from Palau, Micronesia. PLoS ONE 3(3): e1780.)

Het onderzoek is vandaag gepubliceerd door het online tijdschrift PLoS ONE.
°
Antropoloog Lee Berger van de universiteit van Witwatersrand ontdekte de fossielen in twee grotten op rotseilandjes bij het hoofeiland van Palau.
°
De botten en schedels zijn afkomstig van 26 individuen en blijkens koolstofdatering 1400 tot 3000 jaar oud. De mannen moeten zo’n 40 kilo hebben gewogen, de vrouwen circa 30 kilo. Berger vermoedt dat de mensjes van Palau zo klein waren door een proces van ‘eiland verdwerging’. Dit fenomeen is ook bekend van uitgestorven diersoorten als mammoets. Het komt voor bij geïsoleerde eilandpopulaties als een evolutionaire aanpassing aan een omgeving met zeer beperkte voedselbronnen.
°
Een andere mogelijkheid is dat de dwergmensen het product waren van een genetische afwijking die door een lange periode van inteelt is versterkt, aldus Berger.
°
Als de verdwergingshypothese klopt, werpt dat volgens Berger mogelijk ook nieuw licht op de beroemde Floresmens, ook wel ‘hobbit’ genoemd.
°
Een klein skeletje dat  een aparte vroege mensensoort betreft, Homo floresiensis, die tot 13 duizend jaar geleden op het Indonesische eiland leefde.
°
Volgens  Berger,gaat  het ( zeker toch in  Palau),  om  een moderne mens, Homo sapiens, die klein is uitgevallen door een ziekte, of verdwerging.
°
Volgens Berger hebben de mensjes van Palau een aantal fysieke kenmerken met de Floresmens gemeen, zoals de kleine gezichten en lichamen, maar hebben zij niet de kleine schedelinhoud van de hobbit.
°
Hij ziet de overeenkomsten als aanwijzingen dat in elk geval enkele kenmerken van de hobbit verklaard kunnen worden uit een proces van verdwerging( maar dat is iets anders dan eiland -dwerggroei ) .
“Verdwerging” is namelijk het onstaan van een apart  sapiens ras (ondersoort ) van ” pygmeeen “( en misschien  een  beginstadium dat  later tot dwarfisme kan leiden  binnenin   een  specierende    aftakking  van de homo sapiens )
°
De bevindingen van Berger zijn inmiddels van verschillende kanten bekritiseerd.
°
olgens de antropoloog Scott Fitzpatrick, geciteerd op de website Nature News, is verdwerging hoogst onwaarschijnlijk.
°
Fitzpatrick, die ook onderzoek heeft gedaan aan menselijke botten in de grotten van Palau, denkt dat Bergers botten aan kinderen hebben toebehoordDe twee grotten zouden kinderbegraafplaatsen zijn geweest.
°
Fitzpatrick wijst er op dat op Palau in dezelfde periode aantoonbaar ook mensen van normale grootte hebben geleefd.
°
Palau -mensen ?
De Flores mens ,die als volwassene  ongeveer een meter groot moet zijn geweest , behoort( volgens de dominerende consensus )  tot een afzonderlijke mensensoort  : Homo floresiensis.
°
Maar andere groepen antropologen  beto(o)g(d)en dat deze “hobbits ” zo klein bleven ofwel door voedselgebrek (http://news.nationalgeographic.com/news/2008/03/080306-hobbits-cretins.html) en/of genetische defecten/inteelt
ofwel omdat ze gewone pygmee , dwerg en andere ( diverse ) normale varianten met kleine gestalte van homo sapiens  ,waren …
°
Kortom het was/is  de inzet van een controverse die al jarenlang  aan de gang is ,en waar natuurlijk  ook de creationisten  , allerlei oude academische  krokodillen en pensioengerechtigde prestige -jagers zich niet onbetuigd laten ;zodat ze de boel kompleet verzieken
°
Lee Berger (University of the Witwatersrand in Johannesburg, South Africa,) & all,  geven  echter geen dergelijke of andersoortige verklaring voor de Flores skeletten , maar ontdekten wel gelijkaardige overblijselen  op het eiland Palau ( micronesia )in de Stille Zuidzee…
°
Daar  zijn vroeger  al duizenden menselijke beenderen van de oorspronkelijke inwoners van het eiland gevonden (en de voorouderlijke  begraafplaatsen meestal leeggeroofd door souvenirjagers en plunderaars  .)
°
“Deze rotsachtige eilanden bezitten ontelbare grotten en spelonken,waarvan velen een  overvloed aan  fossilerende,  semi-fossiele en subfossiele overblijfselen ,bezitten” schrijven ze in een  artikel  op PLOS http://www.plosone.org/doi/pone.0001780
De nu gevonden  overblijfselen zijn tussen de 900 en 2.900 jaar oud( koolstof gedateerd) . Alle overblijfselen lijken terug te voeren op onze soort,  maar sommige van de beenderen zijn erg klein en vertonen trekken die binnen  de homo sapiens -soort,  eerder  als “archaïsch” of “primitief” kunnen worden beschouwt .( Critici  noemen dat dan weer :”juveniel” )
 _
Berger rekent de  Palau beenderen weliswaar niet tot een nieuwe soort  ; in tegenstelling tot de flores-schedel , vormen  de  Palau schedels geen bewijsstukken voor of aanduidingen van de aanwezigheid  van  een  specifiek ( en naar verhouding ) typisch  kleiner  brein …
http://news.nationalgeographic.com/news/bigphotos/67380441.htmlModel van een moderne vrouwelike schedel (links )vergeleken  met een van de gevonden   Palau schedels (= schededldak ) (midden) en de (vrouwelijke )floresschedel ( rechts )

 °
Berger zegt dat het  kleinere bekken , het gebit  en
de afmetingen van de” grotere “beenderen , typische kenmerken vertonen van echte dwerg-vormen van homosap    — mensen die kleinere ” raciale ” uitgaven  werden  van de normale doorsnee-mens  vanwege de plaatselijke voordelen die dat bood  op  een  eiland met beperkt voedselaanbod en/of   vanwege  de mogelijke genetische beperkingen en inteelt
‘De beenderen waren niet echt typisch en eigenlijk erg klein’ maar ‘Ik voelde meteen dat ik een kleine populatie  van kleine menselijk wezen gevonden had “zei Berger
_
De Palau skeletten behoren duidelijk tot de moderne mensen , benadrukten de onderzoekers. Maar ze zijn nog niet in staat de schedels  nauwkeurig te onderzoeken omdat ze nog grotendeels onder  de druipsteen-afzettingen zitten vastgeklit   
°
 .. De Flores mens bezat een daarmee contrasterende  schedel met kleine hersenpan .
Professor Bert Roberts ( University of Wollongong / australie ) zei dat de vondsten van palau ( = tenminste  25 kleine menselijke skeletten van mensen die ongeveer ergens tussen 900-2900 jaar geleden stierven ),er niet op wijzen dat  “dwergvorming” mensen heeft geproduceerd zoals de flores-mens
Ze ontdekten  prachtige , kleine ,in  vrij recent historisch verleden overleden  , moderne menselijke pygmees …Ik zie niet in hoe dat enig verschil kan gaan maken bij de beoordeling  van de classificatie-status van  Homo floresiensis …Die laatsten zien er helemaal niet uit als moderne mensen …” verklaarde Roberts. “De  volwassen flores  mens heeft geen kin , zijn gebit verschilt van het onze , ook de vorm van  de onderkaak  is verschillend van de homosap -uitvoering . Het flores brein is ongeveer  een kwart van het  onze  en dat is niet het geval bij  homo-sap  pygmees of deze nieuwe vondsten “
De Palau vondsten bezitten veel( zelfs unieke anatomische )kenmerken van de homosap (waaronder de  vele craniofaciale eigenschappen (1)
°
Maar ze bezitten ook gemeenschappelijke karakteristieken met de H. floresiensis; waaronder  ; de kleine lichaamsafmetingen ( toch nog altijd groter dan de flores-mens ) het  smalle en  kleine gezicht ,
geprononceerde  wenkbrauwbogen ,
wijkende  kin, relatieve megadontia,
vergrote  occlusale oppervlakte van de premolairen ,
draaiing van de tanden in  de maxilla en de kaak en
dentale agenesis
°
Berger &all  leiden daaruit echter ook  geen direkte verwantschap af tussen de mensen van Palau en homo floresiensis ….Deze waarnemingen suggereren echter wel dat minstens enkele van die karakteristieken  ( die ooit zijn aangevoerd als criteria om de flores -mens als een aparte soort te classificeren ) gewone “raciale ” aanpassingen zijn in mensen metkleine afmetingen en in een eiland-habitat   
°
De kleine luitjes  van Palau blijken ongeveer dezelfde lichaamslenge  te hebben gehad als de zogenaamde  Homo floresiensis. Maar volgens Berger is de geschatte herseninhoud van de schedels die hij op Palau opgroef ongeveer tweemaal zo groot als die van de ”Mens van Flores”. Ook de vorm van het gelaat en de vorm van de heupen suggereren dat de overblijfselen van Palau tot onze soort, de Homo sapiens behoren.
°
Behalve klein waren de  mensen van Palau lieden met kleine  maar ietwat zwaardere  oogkassen, grote kaakbeenderen en grote tanden. Sommigen hadden een weinig prominente kin.
https://tsjok45.files.wordpress.com/2012/11/18b32-sloan_450.jpg Photo by Stephen Alvarez/짤 2008 National Geographic.
Deze foto  vergelijkt een moderne vrouwelijke onderkaak ( de bekendste onderkaak en enige   komplete schedel van flores is ook vrouwelijk)  met die van een palau-vondst

 °
Berger:  De gereduceerde kin en de vertikale afmeting  zijn twee  primitieve ( volgens andere antropologen = juveniele pygmee ) kenmerken
°
” Deze vondsten en constateringen  zijn  wetenschappelijk gezien , nog niet helemaal OK  “zegt Scott Fitzpatrick, een antropoloog  van de  North Carolina State University in Raleigh, die de Palau -regio al meer dan tien jaar lang bestudeerde
“Er is hier op dit ogenblik  nog grote  nood aan een onafhankelijke bevestiging en peer-review …”
 °
De Palau beenderen  kunnen gemakkelijk resten  zijn  , gevonden  op een kinderbegraafplaats…. Fitzpatrick vond  juveniele beenderen  op de begraafplaats van Orrak , vier kilometer ten  noorden van  Berger’s sites.
 °

 Het kan heel goed de gewoonte  geweest zijn om  kinderen samen te begraven op dezelfde plaatsen ” 

 °
De beenderen die Berger beschrijft komen uit twee begraafplaatsen  die 15 kilometer uit elkaar liggen , en reeds lang bekend zijn bij wetenschappers , toeristen en plunderaars
Een site (  Ucheliungs,) noemt in de spreektaal gewoon ” tarzan’s grot “, omdat mensen daar recreatief plegen rond te slingeren aan de plaatselijke lianen en klimplanten De tweede vindplaats r, Omedokel — de “botten-grot ” â€” ligt vlak in het centrum van  een  toeristische duikzone-streek   en bezat ooit veel beenderen , schedels , potscherven  , vaatwerk en andere artefacten,  die allang zijn weggeroofd …
 °
De oudste beenderen werden gevonden binnen in de spelonken . De jongste lagen bij de ingang van de grotten. Deze laatste zijn van normale lengte, maar de oudste overblijfselen zien er vreemd en veel kleiner uit. Ze behoorden toe aan mensen die slechts 90 tot 120 centimeter groot waren. En tussen de 28( vrouwen  ) en de 41 kilo( mannen ) wogen.( het  geschatte gewicht van het grootste   flores-mannetje  is ongeveer 30 kgr )
°
Fitzpatrick vraagt zich af waarom deze Palau  mensen  “dwerggroei” zouden  hebben vertoont ,terwijl ook homo sapiens individuen  met normale lichaams-afmetingen op het eiland rondliepen op hetzelfde moment van de geschiedenis
°
“Dit lijkt me toch erg vreemd “  zegt hij
°
Fitzpatrick ontdekte vroeger al dat de oudste  begrafenis-oorden in de Westelijke Pacifiek dateren van  3,000 jaar terug
°
Gedetailleerde  analysis van de Palau specimens zal waarschijnlijk de controverse  rond de floresmens niet definitief kunnen oplossen ;de breingrote is daarbij het struikelblok
 °

Maar niettemin zijn enkele eigenschappen van de flores-mens allicht het resultaatvan de omgevings-factoren en niet uitsluitend  van voorouderlijke soorteigen  genetische erfenissen

°
De Palau skeletten kunnen  allicht   wel uitsluitsel brengen over het zogenaamde /veronderstelde  “proces van eiland-verdwerging “in menselijke populaties  en over de oude kolonisatie- geschiedenis  van oceanie . Het is natuurlijk ook nog  erg onduidelijk wat er exact is gevonden en er is ___ zoals gewoonlijk___ een  hoop populaire en voorbarige conclusie-jumping in de media :
 Het lijkt ook een klassiek voorbeeld van wat allemaal kan verkeerd gaan wanneer wetenschap en review-proces worden aangedreven door de populaire media “
verklaarde Tim White,paleoantropoloog   van de ” University of California, Berkeley.”
°
zie ook :
evodisku 2
Klik hier om een link te hebben waarmee u dit artikel later terug kunt lezen.Hobbit is aparte soort ? 

(1)
°
zoals : : “a distinct maxillary canine fossa,
a clearly delimited mandibular mental trigone (in most specimens” ), gematigde knobbel-vorming op de frontale en  parietale squama,
a lateral prominence on the temporal mastoid process,
reduced temporal juxtamastoid eminences and
a “en maison “cranial vault profile with the greatest interparietal breadth high on the vault. 

PHOTOS: Ancient Small Humans’ Bones Found on Island

Palau  ontdekking  …/ Berger

Maarten Keulemans/De minimensjes van Micronesië

°
Wat gebeurt er als je een groep mensen achterlaat op een eiland en ze daar duizenden jaren lang laat zitten?
°
Dan krimpen ze en beginnen ze warempel steeds meer te lijken op onze verre voorouder, de oermens Homo erectus. Dat beweert althans de Zuid-Afrikaanse paleoantropoloog Lee Berger. Welkom in de absurde wereld van de reuzenrat, de miniolifant en de baby-etende ooievaar.
°
Het had zo in Gullivers Reizen gekund: een eilandje, bevolkt door dwergen. Toch is dat wel wat een zeereiziger in de Middeleeuwen zou hebben aangetroffen in de Stille Zuidzee, op de geïsoleerde, rotsachtige eilanden van de Palau-archipel.
°
In twee grotten op een eilandje met de exotische naam ‘Chelechol ra Orrak’ vond een onderzoeksteam onder leiding van de Zuid-Afrikaanse paleoantropoloog Lee Berger de skeletten van vele tientallen minimensjes. De dwergen werden er zo’n duizend tot drieduizend jaar geleden neergelegd – of bleven er dood liggen na een of andere natuurramp, dat kan ook. Het waren ontegenzeggenlijk moderne mensen, van het soort Homo sapiens. Alleen: ze waren nogal klein.
°
De bewoners van Palau waren amper anderhalve meter hoog, iets kleiner waarschijnlijk nog dan een pygmee, stelt Berger vast, overigens zonder een precieze lichaamshoogte te noemen. Berger en zijn team viel nog iets op. De minimensjes van Micronesië zagen er raar uit. Oermensachtig, zelfs. De schedels die zijn team uit de grotten bikte, hadden kleine gezichten, teruggetrokken kinnen, zware wenkbrauwen en opvallend grote tanden en kiezen. Ze leken verdacht veel op de beroemde ‘hobbitmens’ van het Indonesische eiland Flores, Homo floresiensis, meldt Berger in zijn onderzoeksverslag (Plos One, 2008).
°
Berger schrijft het plechtig: “De Palauaanse specimens ondersteunen op zijn minst de mogelijkheid dat de Flores-homininen gewoonweg een aan een eiland aangepaste populatie van Homo sapiens zijn.
 °
Maar bij het Leidse Natuurhistorisch Museum Naturalis komt die volzin aan als een klap in het gezicht van onder meer conservator fossiele grote gewervelde dieren en eilandkenner John de Vos. De zoveelste keer dat iemand ontkent dat de hobbitmens écht iets heel bijzonders is, verzucht De Vos.
°
Er wordt hier voortdurend bagger over ons uitgestort”, constateert hij.
°
Heet gewassen
°
Het begon allemaal vier jaar geleden. In de fossielenrijke grot Liang Bua op Flores vond een onderzoeksgroep onder leiding van de Australiër Mike Morwood toen iets ongekends: de versteende botten van zes werkelijk absurd kleine mensjes.
°
Bij leven waren deze ‘hobbits’ niet groter dan een meter, en hun herseninhoud was kleiner dan die van een mensaap: 380 milliliter (de moderne mens zit op 1500). Toch waren de hobbits ontegenzeggenlijk mensachtig. Ze hadden stenen werktuigen en jaagden, blijkens de slachtresten die bij de hobbitbotten werden aangetroffen, op olifanten en ander eilandwild.
°
Maar dat was niet alles. De skeletten die Morwood en collega’s vonden, leken ook in vorm niet op die van moderne mensen. Het bekken was aapachtig, de kin teruggetrokken, de wenkbrauwen dik, en daarboven had de hobbit geen voorhoofd, maar een plat schedeldak. Morwood meende te weten waarmee hij te maken had: de klassieke oermens Homo erectus, maar dan te heet gewassen.
°
Gekrompen tot idioot kleine proporties, dankzij een bizar evolutionair verschijnsel dat bekendstaat als het eilandeffect
°
.
Dat effect is inmiddels een klassieker in de evolutiebiologie. Isoleer een groep beesten op een eiland, en onder de juiste omstandigheden zet de evolutie een krankzinnig proces in gang, ruwweg samen te vatten als: kleine dieren worden groot en grote dieren worden klein. Omdat er op een eiland van beperkte afmeting onder de zoogdieren doorgaans geen roofdieren zijn, worden grote beesten langzamer.
°
Hun poten worden korter en dikker, en hun tred behoedzamer, alsof de evolutie hun overbodig geworden capaciteit om te vluchten overboord kiepert en verruilt voor het vermogen om voorzichtig te grazen.
 °
Kleine dieren kunnen juist gaan groeien, omdat er genoeg te eten is en de evolutionaire druk van roofdieren is weggevallen. In een van de magazijnen van Naturalis, op de zestiende verdieping, geeft gastonderzoeker Hanneke Meijer een kleine rondleiding.
 °
We lopen langs eindeloze rijen bruine archiefdozen, met daarin de botten van een aantal inmiddels uitgestorven dieren, die door de jaren heen zijn opgegraven op (voormalige) eilanden in de Middellandse Zee en het huidige Indonesi챘.
 °
De Latijnse soortnamen op de dozen hebben achtervoegsels als Gigantea, Magna, Gargantua. Het betreft hier dan ook reusachtige ratten, supergrote hamsters, ontzaglijke uilen en buitenproportionele egels.
°
Maar de fossiele botten van dieren die juist sterk zijn gekrompen op een eiland, die zitten ook in de dozen.
°
“Moet je dit zien. Dit is echt bizar”, kondigt Meijer aan terwijl ze het deksel van een van de dozen licht. Op de bodem van de doos liggen de beenderen van een dier dat blijkens het opschrift een nijlpaard is, maar dan belachelijk verkleind. Afkomstig van Cyprus, vertelt Meijer. “Dit is heel wat anders dan die bakbeesten in Afrika. Dit nijlpaard kwam tot híér” – en ze bukt om haar hand op kniehoogte te houden.
°
Tandartsvulling
°
Ook het Flores van pakweg 18.000 jaar geleden had zo’n surrealistische eilandfauna. Een moderne mens die er zou rondlopen, zou zich in een soort sprookjespark wanen. Daar is de reuzenrat, een monster van een halve meter lang, en daar de reuzenvaraan – het enige eilandwezen dat nog bestaat, de komodovaraan. En kijk, daar loopt de gekrompen olifant. In die omgeving was een tot één meter gekrompen Homo erectus met hersenen zo klein als een appeltje gewoon meer van hetzelfde.
°
Een minuscuul oermensje, dat kon er op Flores best nog wel bij, besefte men in Leiden.
Maar lang niet iedereen is van die logica overtuigd. En dat is zachtjes uitgedrukt: sinds Morwood en zijn collega’s de ontdekking op Flores in het blad Nature rapporteerden, is het huis te klein in de toch al intieme wereld van de oermenskunde.
Het lijkt wel alsof iedereen die zichzelf respecteert een alternatieve verklaring voor die hobbit moet aandragen”, zegt De Vos. “De een roept: het is de ontwikkelingsstoornis cretinisme, de volgende heeft weer iets over het schouderblad, een ander denkt dat de hobbit het syndroom van Laron heeft of dat het een Homo sapiens is met microcefalie (een onderontwikkelde schedel – red.).”
De laatste maanden kreeg de hobbit de wind opnieuw van voren. Zo meende onderzoeker Maciej Henneman te zien dat een kies van de hobbit een tandartsvulling heeft – een teken dat het een moderne schedel is – terwijl anderen het wezentje juist meer ‘aapachtige’ trekjes toedichten, vanwege zijn opvallend grote voeten.
°
En daarbovenop is er Berger met zijn minimensjes van Palau. Enerzijds bevestigen die het eilandeffect. “Deze vondst is een sterke aanwijzing dat evolutie versneld kan optreden, in misschien wel enkele eeuwen tijd”, zoals Berger het verwoordde in een documentaire die National Geographic Channel in april over de zaak uitzond.
°
Anderzijds zouden de kleine kinnen en de zware wenkbrauwen van de Palau-mensjes erop duiden dat krimpende mensen nu eenmaal – hoe bizar het ook klinkt – weer trekjes krijgen van oermensen.
°
Je reinste onzin, menen ze bij Naturalis.
Afgezien van dat de vondst op Palau moeilijk is te beoordelen zonder de fossielen zelf te bestuderen –
°
“Op zo’n plaatje zie ik niks”, klaagt De Vos – werkt het eilandeffect anders.
 °
Bij het eilandeffect krijgen de dieren en mensen echt een ander geproportioneerd lichaam, met bijvoorbeeld kortere poten en grotere ogen. “En dat zie ik zo snel niet bij die Palau-mensen”, zegt De Vos. Ze zijn weliswaar kleiner, maar hebben hun menselijke vorm min of meer behouden. Het échte eilandeffect vervormt lichamen juist.
°

Dat zit bij eilandbewoners ook, letterlijk, tussen de oren. De hersenen van de hobbit van Flores zijn kleiner dan klein – zó ver gekrompen dat ze niet meer in verhouding staan tot de rest van zijn lichaam. Maar de Palau-mensjes hadden een nog alleszins redelijk hersenvolume, van tegen de duizend milliliter. Dat zit aan of misschien net onder de grens van wat nog ‘normaal’ wordt beschouwd voor onze soort, maar staat wél in verhouding tot hun absurd kleine lichaamslengte.

_

“Homo floresiensis gaat eerder de kant op van onze veel verdere, meer aapachtige voorouder australopithecus”,

vertelt vanuit Bandung de Nederlandse onderzoeker Gert van den Bergh, die al vele jaren opgravingen doet in onder meer de hobbitgrot Ling Bua op Flores.

“Het bekken van de hobbit wijkt bijvoorbeeld af. Het ilium (het darmbeen, de ‘vleugels’ aan het bekken, red.) loopt veel wijder naar buiten. Dat hangt samen met een grotere darmlengte en duidt erop dat die hobbits meer planteneter waren, in plaats van een gespecialiseerde vleeseter.”
°
Vogelbotten
°
Op één punt zijn Berger en het Flores-team het eens: de hobbits van Flores waren vele duizenden jaren langer onderhevig aan eilandwerking dan de minimensjes van Palau.
°
Dus misschien waren de Palau-dwergjes wel alsnog veranderd in kindvormige wezentjes met korte benen en een extra kleine hersenpan – als ze negenhonderd jaar geleden niet plotseling om onduidelijke redenen van het eiland waren verdwenen.
°
In Leiden brengen Meijer en haar collega’s inmiddels rustig het volgende wapen ten faveure van de hobbit in stelling: alweer een sensationeel eilanddier.
°
Meijer doet onderzoek naar de duizenden vogelbotten die ook in de hobbitgrot zijn gevonden: botjes van gierzwaluwen, uilen, arenden, havikjes, papegaaien.
°
Bij sommige daarvan zijn duidelijke tekenen van extreme groei waarneembaar.
Zo bleek er op Flores een kolossale maraboe te hebben rondgestruind.
Ook Van den Bergh zet het onderzoek voort. Samen met enkele collega’s heeft hij onlangs de gekrompen olifant van Flores beschreven als een aparte subsoort (Quarternary International, 2007).
 _
De olifant was 30 procent kleiner dan zijn voorouder die 900.000 jaar geleden op Flores kwam – en die op zijn beurt ook alweer 30 procent kleiner was dan de vastelandvorm.
 –
Zie het voor u: een olifant ter grootte van een flink dressoir. “Homo floresiensis was gewoon onderdeel van die fauna die daar op dat eiland bestond”, zegt Meijer.
Conservator De Vos intussen kiest het bredere perspectief. In een overzichtsartikel dat binnenkort verschijnt in het gespecialiseerde vakblad Journal of the History of Biology verbindt hij de rel rond de hobbit met de ophef die destijds ontstond na de ontdekking van de eerste Neanderthaler en de eerste Homo erectus
°
“De reactie op een nieuwe mensensoort is steeds vergelijkbaar”,
stelt De Vos.
°
Bij erectus zei de ene helft dat het een microcefaal is en de andere helft vond het een aap. Bij de Neanderthaler dacht men dat het ging om een halve gek. En bij de hobbit zie je die typerende reactie weer. Men wil gewoon niet accepteren dat iets nieuw is. Dat gebeurt pas na een generatie.”
°
Dat geldt des te meer voor minimensjes die op eilanden wonen.
Reuzenratten en mininijlpaarden, dat is tot daar aan toe.
Maar mensen die nu eens niet ver verheven staan boven de natuur, maar die zijn gekneed – gekleineerd zelfs – door de evolutie; dát is voor veel onderzoekers wat veel van het goede.
 °
De Vos: “Mijn kleine olifantjes, daarvan zegt niemand wat. Maar nu is het een mens en dan is het anders.”

bron :

NWT nr. 6/2008/ Natuurwetenschap & Techniek.

http://www.nwtonline.nl/00/nt/nl/47/artikel/10657/De_minimensjes_van_Micronesi%C3%AB.html (pag. 58)

°

Hobbit van Palau ‘niets bijzonders’

26 augustus 2008

°

De vondst van een zeer klein menselijk skelet op het Zuidzee-eiland Palau vorig jaar, is geen aanwijzing voor het bestaan van een dwergvolk op het eiland, duizenden jaren geleden.

°
Dat stellen archeologen van de North Carolina State University dinsdag in het online tijdschrift PlosOne. ‘De vroegste Palau-mensen hadden normale menselijke afmetingen en vielen binnen de normale vanriatie van moderne menselijke populaties’, aldus de onderzoekers. Vorig jaar leidde de vondst van de resten in een grot op Palau tot speculatie over een parallel met eerdere vondsten op Flores van de resten van een Homo erectus-achtige van nog geen meter groot en circa 18 duizend jaar oud.
°
Volgens archeoloog Scott Fitzpatrick en zijn team is de vondst op Palau van een volkomen andere orde.
°
De skeletdelen vallen binnen de bekende variatie van lengte in moderne mensen. Er is geen sprake van een dwergachtige voorouder, aldus de onderzoekers.


” ….Our evidence indicates the earliest inhabitants of Palau were of normal stature, and it counters the evidence that Berger, et al, presented in their paper indicating there was a reduced stature population in early Palau,” said University of Oregon anthropologist Greg C. Nelson. “Our research from whole bones and whole skeletons indicates that the earliest individuals in Palau were of normal stature but gracile. In other words, they were thin.”

 

A close-up view of the teeth shows their size as well as betel staining — a red byproduct of chewing betel, an Areca palm nut along with slaked lime and leaf of the Piper betel vine. Betel has slight stimulant and medicinal qualities. (Credit: Photos by Jim Barlow)

http://www.sciencedaily.com/releases/2008/08/080826205936.htm

°

HUMOR  ? Flores mens was mogelijk viervoeter ? Diemen (NL) – Homo floresiensis (bijnaam Hobbit) liep mogelijk op handen en voeten.

°

Die conclusie trekt de Nederlandse paleontoloog Gert van den Bergh uit de analyse van de skeletdelen van de Floresmens, die vandaag is gepubliceerd in Nature.

°

Van den Bergh is gespecialiseerd in eilandfauna’s. Vanaf begin jaren negentig heeft hij opgravingen gedaan op het Indonesische eiland Flores, waar hij onder andere zocht naar resten van dwergolifanten. Zowel in 2003 als in 2004 maakte hij deel uit van het Australisch-Indonesische onderzoeksteam, dat Hobbit in de Liang Bua-grot op Flores heeft gevonden. De publicatie in Nature in oktober 2004 over de in 2003 gevonden schedel was wereldnieuws. De vondsten uit 2004 staan beschreven in het Nature-artikel dat vandaag uitkomt.

°

Van den Bergh is geen coauteur van het artikel, maar werkt nog altijd nauw samen met de auteurs van het stuk. Ook deze zomer deed het team weer opgravingen op Flores, maar helaas niet in de Liang Bua-grot, omdat de Indonesische overheid geen vergunning had verstrekt. Een kort vraaggesprek met Van den Bergh.

°

Waarom denk jij dat Hobbit op handen en voeten liep?

De sterkste aanwijzing vind ik het opperarmbeen. Het opperarmbeen van Homo sapiens en Homo erectus is sterk getordeerd. Bij Hobbit zit dit bot echter vrijwel recht op de schouder. Dit zie je niet bij de Australopithecus, niet bij erectus, niet bij mensapen, niet bij chimpansees, maar wel bij gibbons en makaken! Het gevolg is dat de schouder van Hobbit veel minder mobiel is. Die kon haar armen vermoedelijk wel goed voorwaarts-achterwaarts bewegen, maar veel minder makkelijk zijwaarts, zoals wij dat kunnen. Dit impliceert dat Hobbit mogelijk op handen en voeten liep om goed tegen steile wanden en in bomen te kunnen klimmen, net zoals een makaak doet. Dit zou een aanpassing aan het leven op het onherbergzame Flores kunnen zijn, dat voornamelijk bestaat uit zeer steile berghellingen.”

Wie is de voorouder van Homo floresiensis?

Dat is de grote vraag. We dachten aanvankelijk dat Hobbit afstamt van Homo erectus en ik vind dat eigenlijk nog steeds het meest logische. Het skelet van Hobbit vertoont echter ook duidelijke kenmerken van de Australopithecus, een voorouder van de Homo erectus, die een paar miljoen jaar geleden in Afrika leefde. Zo heeft Homo floresiensis net als Australopithecus langere armen en handen en naar buiten staande heupen. Er zijn in Azië echter nog geen eenduidige resten gevonden van Australopithecus, dus mocht Hobbit daadwerkelijk van de Australopithecus afstammen, dan komt mogelijk de Out of Africa-theorie – het idee dat onze vroege voorouders ook al uit Afrika kwamen – op losse schroeven te staan. Elders op Flores hebben we deze zomer ruim 350 werktuigen gevonden, die 800.000 jaar oud zijn. Aangezien Homo erectus toen ook op Java voorkwam, is het aannemelijk dat erectus zo vroeg al de diepe zeestraat tussen Bali en Lombok is overgestoken. Tijdens de tsunami van afgelopen december hebben we gezien dat mensen, die zich vastklampten aan drijvende bomen, na een week nog levend uit zee werden gevist. Hetzelfde kan destijds met de erectus zijn gebeurd. In de honderdduizenden jaren daarna kromp erectus geleidelijk aan tot Homo floresiensis. Deze aanpassing aan een geïsoleerd leven op een relatief klein, zeer bergachtig eiland, leidde waarschijnlijk ‘toevallig’ tot overeenkomsten met Australopithecus.

 

Sceptici beweren dat Hobbit een Homo sapiens is met de hersenziekte microcefalie. Schept het vandaag gepubliceerde Nature-artikel duidelijkheid over deze kwestie?

Het artikel geeft een opsomming van de botten van meerdere individuen die we in de Liang Bua-grot hebben gevonden. De analyse bevestigt onze eerdere conclusie dat het hier om een nieuwe mensensoort gaat. De kritiek van sceptici dat het floresiensis-skelet zou hebben toebehoord aan een moderne mens die leed aan de hersenziekte microcefalie lijkt niet langer houdbaar. Hobbit was vermoedelijk dertig jaar oud toen ze stierf, wat behoorlijk oud zou zijn voor een ‘ziek’ individu. De kaak van een tweede individu, dat 3000 jaar jonger is, lijkt bovendien sprekend op de eerste kaak die vorig jaar al is besproken. Deze tweede kaak en de botten van andere individuen duiden op zelfs nog iets kleinere wezens dan het vorig jaar beschreven skelet (waarvan de schedel gevonden is).

Het is zeer onwaarschijnlijk dat er een hele populatie van microcefalen geweest zou zijn die duizenden jaren heeft voortgeleefd. In een nieuwsbericht op de website van Nature klaagt de Australische onderzoeksleider Mike Morwood dat jullie wellicht nooit meer opgravingen mogen doen in Liang Bua. Wat is daar de reden van?

In Indonesië« heeft de 75-jarige paleoantropoloog Teuku Jacob veel invloed. Hij zit op zijn zachtst gezegd niet op één lijn met ons. Zo vindt hij nog steeds dat Hobbit een sapiens met microcefalie is. Eind vorig jaar liet hij de schedel en diverse botten tegen de zin van de meeste teamleden vanuit Jakarta overbrengen naar zijn instituut in Jogyakarta. Vervolgens vlogen de beschuldigingen over en weer hetgeen tot verdere escalatie leidde. Uiteindelijk moest Jacob de botten onder druk van hogerhand in Februari dit jaar teruggeven aan het instituut in Jakarta. Tot grote ontzetting van de teamleden kwamen sommige botten zwaar beschadigd terug. Dit werd meteen al heel ‘on-indonesisch’ door de Australiërs naar buiten gebracht, hetgeen tot verder gezichtsverlies van Jacob zou kunnen leiden, ware het niet dat Jacob in Indonesië zelf de media sterk onder controle lijkt te hebben. Jacob beschuldigt het onderzoeksteam van wetenschappelijk kolonialisme en probeert nu via hoge functionarissen binnen de Indonesische overheid de Australiërs te beletten om verder onderzoek in Indonesië te doen. Zonder geld uit het buitenland zijn opgravingen zoals in Liang Bua echter vrijwel onmogelijk. We hebben pas één procent van Liang Bua onderzocht en er liggen nog zoveel vragen open dat het doodzonde zou zijn als politieke sentimenten de opgravingen dwarsbomen.

Marcel Crok

Hobbit20Cover20NW26T20nov202005

Hobbit As Monkey?

10/27
°
Peter Brown, the anthropologist on the hobbit team, is not impressed. In an email reply, he wrote: ” ….Absolute nonsense! Completely inconsistent with the anatomy of the LB1 skeleton, which is consistent with that of an obligate biped. Simply no way the limbs could have functioned like this. Anatomy of the cranial base, pelvis, legs, feet, hands… all those of an obligate biped….”
10/27 Dan Lieberman, a Harvard anthropologist who has been a careful observer of H. floresiensis research:
” …. Very amusing and one of the silliest ideas yet I’ve seen regarding this odd skeleton. But I like the figure! Their idea its a monkey comes from the humeral torsion, but it really is clearly a biped in so many features that the idea is, well, silly…..Just goes to show that one can publish anything somewhere…” 1.- ….if the vegetation on Flores was as it is now(?) some of the suspected drivers for bipedalism vanish. Floresiensis could (among many possibilities) have reverted to cuadripedalism or knuckle-walking (or never have left those practices). Some suspect that chimps and gorillas had upright ancestors….. 2.- ….What Van den Bergh is refering too is humeral torsion. In humans and apes there is a large amount of it – although least in the gorillas, which spend a lot of time on the ground. It should be pointed out that gibbons are not quadrupedal. The exact relationship between humeral torsion has not been worked out. For more info Aiello and Dean’s “An introduction to human evolutionary anatomy” and references their in for more details.
5. Tabitha M. Powledge on October 28, 2005
One of my sources raised this point in my October 13 story in The Scientist: http://www.the-scientist.com/news/20051013/02
” …Schwartzis a major expert on hominid remains who says he has examined many of the actual examples of hominids, not casts. (Those of you with FT access to Science, see his review on Homo erectus in the July 2 2004 issue.)Until someone publishes a serious critique of Liang Bua stratigraphy, Schwartz’s speculation that the bones may represent different taxa is not so easily dismissed, IMHO. It’s very easy to forget a crucial aspect of this site. It’s not a living or burial site. All those bones and other artefacts washed into the cave during tropical rains and flooding. No one knows where they came from…”
6.Peter Brown on October 28, 2005 writes…
….Schwatz’s speculation about multiple taxa makes absolutely no sense. Is he, for instance suggesting that the arms of LB1, belong to a different taxa to the rest of the body. Or, the postcranial bones which share numerous features with the first skeleton, belong to different taxa. Its not as if there were even any other primate taxa on Flores during the Pleistocene. As for articulated skeletons being washed into the cave… “
 °

One More Homo Species? 3D-comparative analysis confirms status of Homo floresiensis as fossil human species

The Liang Bua 1 (LB1) cranium, shown in right side view.
1http://www.sciencedaily.com/releases/2013/07/130710182420.htm
10 july  2013
Stony Brook University
Summary:
Based on the analysis of 3-D landmark data from skull surfaces of Homo floresiensis, scientists provide compelling support for the hypothesis that Homo floresiensis was a distinct Homo species.
Floresiensis and modern man
____________________________________________________________________
°
UPDATING  2014 

Flores bones show features of Down syndrome, not a new ‘Hobbit’ human

August 4, 2014  Penn State
Summary:
In October 2004, excavation of fragmentary skeletal remains from the island of Flores in Indonesia yielded what was called ‘the most important find in human evolution for 100 years.’ Its discoverers dubbed the find Homo floresiensis, a name suggesting a previously unknown species of human.
LB1 is shown in three different views to illustrate facial asymmetry. A (left) is the actual specimen, B (middle) is the right side doubled at the midline and mirrored, and C (right) is the left side doubled and mirrored. Differences in left and right side facial architectures are apparent, and illustrate growth abnormalities of LB1.
Credit: Image A, E. Indriati; Image B and C; D.W. Frayer
°
LB1 and Liang MomerE
Image: © Photograph of Liang Momer E skull taken at Naturalis Biodiversity Center (Leiden, Netherlands.) All Rights Reserved

This figure compares the skull of LB1 to that of Liang Momer E, another skull from Flores, dated in the range of 3000 to 5000 years ago.

 

DOWN SYNDROME ?

The published papers are available at ;

http://www.pnas.org/content/early/2014/07/31/1407382111.abstract andhttp://www.pnas.org/content/early/2014/07/31/1407385111.abstract.

Additional context is available on the authors’ website at
http://www.LiangBuaCave.org.

http://news.psu.edu/story/322149/2014/08/04/research/flores-bones-show-features-down-syndrome-not-new-hobbit-human

http://www.sciencedaily.com/releases/2014/08/140804151510.htm

°

Floresmens was geen nieuwe soort, maar had Downsyndroom

 

 

 

In 2004 stelden onderzoekers dat ze een nieuwe mensensoort hadden ontdekt: Homo floresiensis. Maar nieuw onderzoek stelt nu dat het helemaal geen nieuwe mensensoort is. Het is een mens die het Syndroom van Down had.

Homo floresiensis werd in 2004 aangekondigd als een heel belangrijke ontdekking die meer inzicht zou geven in de evolutie van de mens. De conclusie dat er een nieuwe mensensoort was ontdekt, was gebaseerd op de vondst van resten van één mensachtige: LB1. De resten werden ontdekt in een grot op het Indonesische eiland Flores.

Anatomische kenmerken
LB1 – die ongeveer 15.000 jaar geleden leefde – had volgens de onderzoekers verschillende anatomische kenmerken die deze overduidelijk van de mensachtigen die we reeds kenden, onderscheidden. Denk aan een uitzonderlijk kleine schedel (66 procent kleiner dan de schedel van de moderne mens) en heel korte dijbenen waardoor deze net één meter lang was. Dat laatste leverde de nieuwe mensensoort de bijnaam ‘hobbit’ op.

Omstreden
Andere wetenschappers omarmden de ontdekking van H. floresiensis niet zomaar. De conclusie dat een nieuwe mensensoort was ontdekt, was omstreden. Want waren de resten wel van een nieuwe mensensoort? Ging het niet gewoon om de resten van een mens met een verstoorde ontwikkeling? Een internationaal team van onderzoekers stelt nu dat al die kritische reacties terecht waren. Homo floresiensis is geen nieuwe mensensoort. Het is een mens met een verstoorde lichamelijke ontwikkeling die bovendien diverse kenmerken vertoont die doen denken aan het Syndroom van Down.

Schedel
Ten eerste stellen de onderzoekers dat de wetenschappers die H. floresiensis ontdekten de omvang van de schedel onderschat hebben. Nieuwe metingen onthullen dat het volume niet beperkt blijft tot zo’n 380 milliliter (oftewel minder dan één derde van het brein van de moderne mens). Het brein van LB1 zou een volume van ongeveer 430 milliliter hebben. “Die verandering is significant,” stelt onderzoeker Robert B. Eckhardt. Hij wijst er bovendien op dat mensen met het Syndroom van Down die tegenwoordig in dit gebied wonen, een vergelijkbaar hersenvolume kunnen hebben.

“DE KENMERKEN DIE IN HET OORSPRONKELIJKE ONDERZOEK WORDEN AANGEHAALD ZIJN NIET ZO ZELDZAAM DAT ZE DE UITVINDING VAN EEN NIEUWE MENSENSOORT RECHTVAARDIGEN”

Dijbenen
De conclusie dat H. floresiensis ongeveer iets meer dan een meter hoog was, was gebaseerd op een extrapolatie. De onderzoekers lieten zich daarbij leiden door de korte dijbeenderen van LB1. Maar ook die korte dijbeenderen en daaruit voortvloeiende beperkte lengte, bewijst volgens de onderzoekers niet dat het om een nieuwe mensensoort gaat. Ze wijzen erop dat ook mensen met het Syndroom van Down kortere dijbenen hebben. “De kenmerken die in het oorspronkelijke onderzoek worden aangehaald zijn niet zo zeldzaam dat ze de uitvinding van een nieuwe mensensoort rechtvaardigen.” En toen de onderzoekers berekenden hoe lang de dijbeenderen van LB1 zouden zijn geweest als deze zich normaal zou hebben ontwikkeld, ontdekten ze dat de totale lengte van deze mens dan ongeveer 1.26 meter zou zijn geweest. Dat komt overeen met de lengte van sommige mensen die nu op Flores leven.

Meer bewijs
En de onderzoekers dragen nog meer bewijs aan voor hun hypothese dat LB1 geen nieuwe mensensoort, maar een mens met het Syndroom van Down was. Zo wijzen ze er bijvoorbeeld op dat LB1 als enige de bijzondere kenmerken vertoont. Andere menselijke resten die in dezelfde grot zijn teruggevonden laten deze kenmerken niet zien. Het bewijst dat LB1 anders was dan de mensen waar hij zijn leefgebied mee deelde. Daarnaast blijkt de linkerkant van de schedel ietsje anders te zijn dan de rechterkant. Ook dat wijst op het Syndroom van Down.

Dit onderzoek is niet één of ander fantasierijk verhaal, maar is bedoeld om een hypothese te testen,” benadrukt Eckhardt. “Zijn de skeletten uit de Liang Bua-grot zodanig ongebruikelijk dat we ze aan een nieuwe mensensoort moeten toewijzen? Onze nieuwe analyse stelt van niet. Alle signalen wijzen hier duidelijk op het Syndroom van Down.”

Bronmateriaal:
°
Flores bones show features of Down syndrome, not a new ‘hobbit’ human” – PSU.edu
De foto bovenaan dit artikel is gemaakt door Cicero Moraes (via Wikimedia Commons)
°
 REACTIES  UIT DE WETENSCHAPPELIJKE WERELD  en van WETENSCHAPSJOURNALISTEN 
 °
Bloemlezing van lezers-reacties  gevonden   op nieuwssites : 

http://www.nujij.nl/wetenschap/geen-hobbit-maar-syndroom-van-down.29067788.lynkx

//
1.-

Zeer frappant nieuws dat ook nog eens apart is : PNAS geeft deze groep de ruimte om twee keer nagenoeg hetzelfde te publiceren in hetzelfde issue.

* Het bewijs van deze groep dat Homo florensis niet zou hebben bestaan(als aparte mensensoort ) maar dat het om een anomalie gaat , is net zo zacht i.m.o als het bewijs dat H. florensis wel heeft bestaan als aparte mensensoort

(antwoord ) 

“De gevonden botresten van  flo  wijzen op trisonomie …..” volgens deze  down syndroom – hypothese   …

Maar

  • Het enige wat telt is dat men harde feiten vind die wijzen op trisomie 21 ( het liefst van al  voldoende  genetische sequenties   ) van enige soort, de rest is assumptie of extrapolatie   ….
  • Bovendien spelen nog andere morfologische  , ethnografische   en archeologische (=  de vondsten  van werktuigen ) “bewijsvoeringen” en (weliswaar) speculatieve extrapolaties ( maar met hoge waarschijnlijkheidswaarde  ), in het voordeel van de “aparte mensensoort   hypothese” ….

 

* Ik blijf nog immer op mijn hekje (en mijn honger) zitten als het gaat om de “hobbit mens”

 

2.-

Is dit  Creationisten voer ?(of creationistisch geinspîreerd ?) 

  • De controverse over de flores mens bewijst noch  ontkracht de evolutietheorie ( of de huidige  afstammingstheorieën  van de mens, omdat de Floresmens niet onze voorvader was maar een verwant : een  (uitgestorven ) zijtak  .
  • De vraag was alleen: waarom zijn die gevonden mensen zo klein en bezitten ze die morfologisch anatomische kenmerken die zijn gekonstateerd aan de mensachtige  semi-fossiele vondsten van  Flores

En hier zijn wetenschappers naar op zoek gegaan:

  • de eerste wetenschappers concludeerden dat er sprake was van evolutie, en dwarfisme …..
  • en de wetenschappers die dit (sinds de eerste dag van de ontdekking ) aanvechten concluderen  nu  (op basis van hun eigen nieuwe metingen) dat er een  handicaperende groeibeperking ( met name down syndroom )was bij  één belangrijk  gefossileerde  spercimen  van populaties van homo sapiens  .

° Beide standpunten verdienen nog wat meer onderzoek om tot een conclusie te komen, maar geen van beide noopt tot conclusies over evolutietheorie ( het gaat enkel over de Floresmens en of die zo geevolueerd als zijtak van een mensachtige   of dat er sprake is van  een  niet gedetecteerd genetisch defect bij de  semi fossiele vondsten  ).

 

*

“Homo floresiensis  :  een paar (fragmentarische) botvondsten.”

Niet een paar fragmentarische  botresten  maar een redelijk compleet skelet ;Het hoofd was redelijk intact en een groot gedeelte van de rest was ook nog intact maar omdat dit ( in het begin )  om 1 vondst ging tussen diverse andere fossielen werden er direct vraagtekens bij geplaatst   …. o.a. door diezelfde mensen(waaronder ook” multi regionalisten”en ” out of africa ” -ontkenners  )  die nu met de ” down-syndroom hypothese komen

 

 

3.-

(Palaeo)Antropologen vinden (over het algemeen ) de kans dat een fossiel van een “ziek individu” komt nogal klein….

4.-

Telkens proberen wetenschappers een “experiment “ uit ( of in dit geval  meestal  een gedachtenexperiment (=rethinking ) te bedenken om theorieën onderuit te halen,… Maar ook die  voorgestelde  falsificaties zijn  (provisionele) werkhypothesen die dan  andere wetenschappers proberen te falsifieren ; En dan gebeurt er iets als dit. Tsja, dat is dan zo. In 10 jaar is er hopelijk enige klaarheid

(Tsjok )

Het gaat bij deze  groep  bovenvermelde  mensen niet om “RETHINKING “ maar misschien  eerder om ……”DENIAL” (van de status “aparte mensensoort ” van de zogenaamde homo floresiensis )

Tenzij het gewoon louter gewone  “domheid” zou zijn , maar dat laatste acht ik niet echt waarschijnlijk bij dergelijke mensen …. Vakidiotie met oogkleppen (iets waar ook de destijds beroemde anatoom VIRCHOW zich aan bezondigde tijdens de neaderthaler -kwestie ) is ook een mogelijke optie ?

 

DOWN SYNDROOM

 

°

Turners syndroom (= down syndroom) is een ernstige ziekte, naast die schattige oogjes en ogenschijnlijke naivitiet sterft de helft al in de baarmoeder en zal een natuurlijke abortie ondergaan. Als ze het overleven hebben ze vaak geen emotionele en fysieke zelfstandigheid, en lijden vaak aan allerlei hart en vaatkwalen.

 

m.a.w.

De levensduur ( en verwachting)  is dus ook aanzienlijk korter en ook nog eens van mindere kwaliteit .

Je kan het bagetaliseren, maar het is niet te classificeren als een “onschuldige aandoening” .

°

Overdraagbaarheid van  trisonomie 21 

“Wanneer iemand met het syndroom van down voor nageslacht zorgt wil dat niet zeggen dat het kind ook  die  chromosoom afwijking heeft. ”

(En nog afgezien  van het feit of  deze personen    al dan niet  minder   fertiel  ( of zelfs  verhoogd steriel) zouden  zijn  :

  • trisomie 21 wordt NIET doorgegeven met meer dan een normale kans op voorkomen zoals bij “normale” mensen. ( en volgens de mendeliaanse wetten )
  • Alleen bij translocaties van een stukje 21 naar een ander chromosoom ( tijdens de meiose ) is het een genetisch veroorzaakt  mutatie-defect geworden 

http://turners.nichd.nih.gov/genetic.html

 

(Tsjok)

Het risico op deze genetische aandoening (trisonomie ) verhoogt bij moeders boven de 30-35 ….Het is onwaarschijnlijk dat oude moeders rondliepen op het eiland flores
van duizenden jaren geleden …. alles staat en valt dus in de eerste plaats met de datering van de daadwerkelijke vondsten

* Het is trouwens een syndroom dat veel problemen met zich meebrengt. Hartproblemen, skeletafwijkingen, osteoporose, autisme, gastro-intestinale afwijkingen en nog een aantal hinderlijke problemen als huidafwijkingen.

* Het blijven kwetsbare mensen die nooit oud zullen worden en veel zorg nodig hebben

* Ook niet waarschijnlijk dat in de hardere omstandigheden van 18.000 jaar geleden (waar ook ter wereld ) dergelijke mensen lang in leven zouden zijn gebleven

( zie ook reacties onderaan )

“Uiteraard werden veel vrouwen 15000 jaar geleden ouder dan 35 jaar en kregen ze ook kinderen op die leeftijd”

Gralgrathor   // Hier durf ik de nodige vraagtekens bij te zetten.

1. Zelfs nu ligt de gemiddelde leeftijd waarop vrouwen kinderen krijgen wereldwijd nog ver onder de 30, met uitschieters naar boven in de rijke eerstewereldlanden.

2. 15000 jaar geleden lag de gemiddelde levensduur voor leden van het genus Homo rond de 40 jaar, gebaseerd op archaeologische data (eg. slijtage van gewrichten en tanden, vorming van botten en kraakbeen, etc).

Waarschijnlijk lag de gemiddelde leeftijd waarop een vrouw van het genus Homo kinderen kreeg 15000 jaar geleden dichter bij 15 dan bij 20, en mocht men tussen 35 en 40 verwachten kleinkinderen te hebben – zelfs Homo sapiens. Het zal zeker zijn voorgekomen dat vrouwen nog na hun dertigste kinderen baarden, maar ik betwijfel dat het vaak is voorgekomen.

“Dat zal in meer sociaal hechtere samenlevingen minder problemen geven”

Gralgrathor   //Daarentegen hebben primitieve samenlevingen, zelfs als die sociaal hechter zijn, vaak taboes op lichamelijke (laat staan geestelijke) misvorming, en zal het niet ongewoon zijn dat een stam dergelijke kinderen of aan de miereneters voert, of a la Hans en Grietje buiten de gemeenschap sluit (met de dood tot gevolg). Zelfs als de stam een dergelijk kind hielden was waren de leefomstandigheden nog steeds veel zwaarder dan onze moderne maatschappij biedt, en zullen kinderen met een dergelijke lichamelijke en geestelijke achterstand veel eerder het loodje hebben gelegd dan nu het geval is. De kans dat individuen met het syndroom van Down de volwassenheid bereikten moet daarom vrij klein worden geacht – de kans dat men fossiele resten vindt van een volwassen individu met Down dus miniem.

Desondanks:

De bevindingen tot nu toe zijn gebaseerd op een vrij kleine hoeveelheid resten. Ik ben geneigd vanwege mijn opmerkingen hierboven een grotere waarschijnlijkheidswaarde toe te kennen aan posities die H. floresiensis als unieke soort erkennen, maar wil de mogelijkheid dat het hier inderdaad een verwarring van pygmeeën en enkel geval Down betreft ook niet uitsluiten. In plaats van nog meer analyses van dezelfde resten zou ik graag zien dat er meer overblijfselen gevonden werden voordat ik deuren ga sluiten.

 

 

 

(Tsjok )

.er bestaan nog wél   een hoop misvattingen over de “huidige ” toestand van mensen met down syndroom

http://www.nu.nl/media/3845088…http://nl.wikipedia.org/wiki/S…

http://newsmonkey.be/article/7…
waaruit ik bijhet laatste  vooral onthou :

“9. …..
De levensverwachting van mensen met down is de laatste tijd enorm gestegen. In 1983 was de verwachting amper 25 jaar, terwijl dat vandaag in de westerse landen al 50 à 60 jaar is…”

° (Tsjok)  ……Het gaat hier (om   en  bij de flores mens ) over de levensverwachtingen van (homo sapiens ? ) mensen met down s, ingebed in een verzamelaars-jagers gemeenschap , minstens 15.000 jaar geleden ….. Op een eiland met erg beperkte mogelijkheden qua exploiteerbare voedselvoorraden …..

°
Veroorloof me toch enkele verdere “on topic” opmerkingen in dit verband

— Homo sapiens (= floresmens is immers een ondersoort , althans volgens de hier besproken down syndroom-hypothese ) skeletresten van 15.000 jaar geleden met (morfologisch )AANTOONBAAR downsyndroom zijn op zijn minst erg onwaarschijnlijk
( Kan “toevallig” wél want de kans is niet gelijk aan 0)

ECHTER

1—Zolang er geen (analytisch)bruibaar DNA kan worden geextraheert uit de vondsten is daarover geen uitsluitsel te geven

2–Microscopisch onderzoek naar het verdubbelde chromosom ( karyotypering ) is ook niet mogelijk ( naar mijn weten ) omdat daarvoor intacte intacte cellen nodig zijn en die zijn niet meer aanwezig in het semi-fossiele materiaal ( dat drijfnat was en eerder leek op papier maché )

 

°
“Uiteraard werden veel vrouwen 15000 jaar geleden ouder dan 35 jaar en kregen ze ook kinderen op die leeftijd.

°

Kan altijd .… Alleen is een lage GEMIDDELDE levensverwachting van een gegeven bevolking vooral het gevolg van hoge kindersterfte en hoge kraambedsterfte ( kijk maar naar afrika )

Vrouwen hebben onder “primitievere” en in moeilijke omgevingen een groter kans om niet al te oud te worden …. Die problemen worden dan “opgelost “(of minstens uitgesteld) door een streven naar grotere kinderijkdom en de beschikbaarheid van jongere vruchtbare vrouwen die door kraambedperikel kwetsbaar zijn ( en in zoverre het “opkweken ” van meisjesbabies geen al te grote belasting vormen — want infanticide komt ook vaak voor ) en dus een “schaars artikel ” ( polygamie is hierop een antwoord )

Uiteraard kwamen ook mannen veel vroeger om (jachtrisico’s , stamoorlogen en raids —> geillustreerd door(historische ) ethografische studies van o.a. de Papoea’s )

-er bestonden natuurlijk ook matriarchale gemeenschappen ( waar de rollen werden omgekeerd ?) maar niettemin bleef ook daar de kraambed en kindersterfte manifest aanwezig …

PS

Het gaat NIET zozeer om de leefomstandigheden in de moderne (westerse ) wereld of zelfs in de hedendaagse ontwikkelingslanden (waar de mensen met downsyndroom beter kunnen worden opgevolgd ) … maar om de barre en extreme leef-omstandigheden met weinig en schaarse middelen, op een eiland .M;a.w. een omgeving waar veel minder werd “gepamperd ” dan in de meeste omgevingen van de huidige mensenwereld ….

Dwarfisme of dwergroei is daarbij een groot voordeel omdat het minder middelen vergt .

 

.

 

–> Er is  ondertussen  meer voorhanden  dan   één enkele schedel ….. 

Van de complete eerste schedel is uiteraard de “jaw” bekend … maar in diezelfde grot werd ook een tweede  “jaw “ gevonden ( de schedel waartoe die onderkaak behoorde is nog zoek )

—> Ook die tweede kaak bezit GEEN  kin

Tweemaal  dow-syndroom  of zo ?  

 

°

 

 

Here is a picture of the two discovered Homo floresiensis jawbones (one from the skull of the individual desgnated as LB1 and the other from individual whose skull hasn’t been found):
floresiensis jaws

http://anthropologynet.files.wordpress.com/2008/11/homo-floresiensis-mandibles.jpg

Do you think those jawbones are of people with Down syndrome?

he LARGER of those two jawbones belongs to LB1, the individual whose whole skull has been found.

Compare those to the jawbone of a normal human:
homo sapiens jaw

http://www.texasobserver.org/wp-content/legacy/archives/zrl_071005/images/jawbone.jpg

 

 
menselijke kaak gezien van bovenaf
 °
 2.- Dat de gevonden botten van  mensen  met het syndroom van down zouden zijn geweest  is de hypothese van enkele wetenschappers …. Maar het is zeker de consensus niet  ….integendeel 
-Gelukkig zijn de meeste mensen met het  syndroom van down niet even stompzinnige vakidioten   als deze “wetenschappers “
°
occiput

Chororapithecus abessynicus

AFSTAMMING VAN DE MENS en de mensachtige

Tanden van 10 miljoen jaar oude gorilla gevonden

In Ethiopië hebben onderzoekers negen tanden gevonden van een primaat die 10 à 11 miljoen jaar oud is, meldt het wetenschappelijke tijdschrift Nature.
Vermoedelijk gaat het om een exemplaar uit de  voorouderlijke stamlijn van de gorilla  .
De antropologen wijzen erop dat dit betekent dat de mens zich mogelijk vlugger uit de ontwikkelingslijn van de gorilla heeft losgemaakt dan tot nu toe werd aangenomen.Primeur
Het is de eerste keer dat zulke oude resten van een hominoïde worden gevonden en in verband te brengen zijn met een bestaande soort, aldus Gen Suw van de universiteit van Tokio en Berhane Asfawvan de Rift Valley Research Service in Addis Abeba.

De oudste tot nu toe gevonden fossielen van de menselijke soort zijn 6 à 7 miljoen jaar oud.
Oudere fossielen, die teruggaan tot de periode dat de voorouders van de mens zich van de grote apen (gorilla’s, chimpansees, bonobo’s en orang-oetans) onderscheidden, zijn zeldzaam.

Pre-gorilla’
De onderzoekers hebben de “pre-gorilla” de wetenschappelijke naam

Chororapithecus Abyssinicus” gegeven, naar de plaats vanwaar hij afkomst
ig is. Uitgebreid onderzoek heeft hen doen besluiten dat de chororapithecus een plaats had aan de basis van de gorilla-stamboom.Omdat er geen fossiel materiaal is om de laatste gemeenschappelijke voorouder in de tijd te situeren gingen de wetenschappers uit van de genetische afstand tussen de bestaande soort.

Zo zouden de gorilla’s zich 8 miljoen jaar geleden van de mens hebben onderscheiden,
chimpansees 5 à 6 miljoen jaar geleden.
Als de chororapithecus effectief de eerste gorilla was, dan maakte de mens zich al 10,5 miljoen jaar geleden uit de ontwikkelingslijn van de gorilla los. (belga/hln)
Fossil teeth from an ancient ape are thought to be 10 million years old. © Gen SuwaFossil teeth from an ancient ape are thought to be 10 million years old. 짤 Gen Suwahttp://www.nhm.ac.uk/about-us/news/2007/august/news_12280.html

Teeth from the newly discovered Chororapithecus abyssinicus ape compared with a row of teeth from a female gorilla (Image: Gen Suwa)

http://abc.net.au/science/news/stories/2007/2013011.htm

Is het wel een gorilla ?

Zoals  steeds moeten  krantenberichten met de nodige voorzichtheid
worden gelezen … Zelden worden de oorspronkelijke  papers doorgenomen
door de journalisten van dienst

Nature

Oldest gorilla ages our joint ancestor

Fossil teeth from Africa add years to early ape.

Rex Dalton

The last common ancestor of humans and gorillas might have lived at least 2 million years earlier than previously thought. Fossilized teeth of the earliest gorilla ever discovered, dating to 10 million years ago, have been found in Africa, say researchers.The new species (Chororapithecus abyssinicus) from Ethiopia, reported on ‘A new species of great ape from the late Miocene epoch in Ethiopia‘ of this issue, helps to fill in a huge gap in the fossil record. The team of Ethiopian and Japanese researchers has based its conclusion on just nine teeth from at least three individuals of the species, which were discovered in the desert scrubland of Afar about 170 kilometres east of Addis Ababa.

The teeth, eight molars and a canine, “are collectively indistinguishable from modern gorilla subspecies” in size, proportion and scan-revealed internal structure, says Gen Suwa of the University of Tokyo Museum, Japan, who led the study. The team argues that the gorilla’s divergence date from the human lineage is not about 8 million years ago as previously surmised (S. Kumar et alProc. Natl Acad. Sci. USA102, 18842–18847; 2005), but “greater than 10 to 11 million years ago” on the basis of the age of the new species. Functionally, he adds, the teeth already seem to be evolving — they could shear through a plant diet, a gorilla trait — although other herbivore apes also exist in the fossil record.

This finding could prompt discussions of how anthropologists and geneticists determine the hominin line’s divergence from chimps, previously pegged at about 6 million years ago. “Chororapithecus abyssinicus suggests, once again, that Africa was the place of origin of both humans and modern African apes” — not Eurasia as some researchers have argued, says Suwa.But palaeoanthropologist Jay Kelley, who studies primate teeth at the University of Illinois at Chicago and was not involved in the study, is sceptical. “I’m not convinced it is a gorilla,” he says. More fossils, analysis and debate will be needed to determine whether the specimen is ancestral to hominids, he adds. For now, he would be “very cautious” about using the specimen to realign divergence dates between hominins and gorillas–chimps.

Suwa’s team is part of the Revealing Human Origins Initiative (RHOI), a project that searches at multiple sites in Africa, Europe and Asia for species that predate the earliest known hominid, the 7-million-year-old Sahelanthropus tchadensis (M. Brunet et alNature 418, 145–151; 2002).

Between 15 million and 22 million years ago, there were dozens of primate species across Africa and Euroasia — and apes dominated the primate scene. But fossils show that these species don’t share the characteristics of modern African apes. “From that species pool, the common ancestor of African apes and humans branched out,” says Tim White, a palaeoanthropologist at the University of California, Berkeley, and an RHOI director. “And the goal of RHOI is to find the common ancestors. With C. abyssinicus, we now can see an ancestral African ape.”

Article brought to you by: Nature

Figures and Tables

From the following article:

A new species of great ape from the late Miocene epoch in Ethiopia   Gen Suwa, Reiko T. Kono, Shigehiro Katoh, Berhane Asfaw & Yonas Beyene   Nature 448, 921-924(23 August 2007)

Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, or to obtain a text description, please contact npg@nature.com

Figure 1   Full size figure and legend (88K)

Chororapithecus abyssinicus fossils and schematic stratigraphy.

Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, or to obtain a text description, please contact npg@nature.com

Figure 2   Full size figure and legend (123K)

Micro-CT-based morphological evaluations of the outer enamel surface and enamel–dentine junction.

Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, or to obtain a text description, please contact npg@nature.com

Figure 3

Micro-CT-based evaluations of upper molar enamel thickness.

Hieronder volgt een  aantal bemerkingen over de vondst /krantenberichtgeving en    een betrouwbaar  nieuwsartikel  afkomstig van  een wetenschappelijke  instelling

http://news.xinhuanet.com/english/2007-08/23/content_6590068.htm

http://vyoma108.blogspot.com/
http://www.nhm.ac.uk/about-us/news/2007/august/news_12280.html

Nieuwe fossielen duwen mens-aap splitsing verder terug

Erik

sgenoy83240807121647photo00quicklookdefault-245×163.jpg

Tien miljoen jaar oude fossielen die onlangs gevonden zijn in Ethiopi챘, wijzen erop dat de splitsing tussen aap en mens zes of zelfs zeven miljoen jaar eerder heeft plaatsgevonden dan tot nu toe gedacht werd.

Omdat er tot nu geen fossielen voor handen waren van vroege aapachtigen (8 tot 14 miljoen jaar oud), heeft men op basis van ‘genetic distance‘ altijd gedacht dat de splitsing niet veel langer geleden plaatsgevonden zou hebben dan 10 miljoen jaar.

Door het ontdekken van de ‘Chororapithecus abyssinicus’ is bekend geworden dat de voorouders van de gorilla alleen al ouder zijn dan 10 tot 10,5 miljoen jaar.

Aangezien de mens eerder afgesplitst is dan de gorilla, wordt hiermee het ontstaan van de menselijke stamboom tot wellicht wel 20 miljoen jaar geleden verlegd.

Bijkomend is de bevestiging van de ‘out of Afrika‘ theorie die al sinds lange tijd kon rekenen op wetenschappelijke consensus.

Dus, beste creationisten/christenen/moslims/evolutieontkenners:

Ja, u stamt af van een aap, maar wel een hele oude. En nee, u stamt dus niet af van die dieren uit het regenwoud of de dierentuin.

Ik verwacht dus geen vragen meer als: “Oh ja? Als ik afstam van een aap, waarom zijn er dan nog apen”? Daarop zal ik namelijk voortaan antwoorden met: “Als Amerikanen afstammen van Engelse kolonisten, waarom zijn er dan nog Engelsen”?

GENETISCHE MANIPULATIE

 zie onder Genetica

.

Frankenstein-mug moet malaria uitbannen

dinsdag 20 maart 2007

Muggen die door genetische modificatie geen malaria verspreiden, kunnen zich in het wild snel vermenigvuldigen en ongemodificeerde soortgenoten doen uitsterven.

Frankenstein-mug moet malaria uitbannen
Frankenstein-mug is na negen generaties dominant

Amerikaanse wetenschappers maken dat dinsdag bekend in wetenschappelijk tijdschrift Proceedings of the National Academy of Sciences. Malaria, waaraan wereldwijd naar schatting tussen de 1 en 2 miljoen mensen per jaar overlijden, wordt veroorzaakt door de plasmodium parasiet, die wordt overgebracht op mensen via muggebeten.

Dominantie
Wetenschappers kunnen aan muggen een gen toevoegen dat ze resistent maakt voor de parasiet, maar tot nu toe waren de transgene insecten door hun modificatie te zwak om in het wild te overleven. Maar de nieuwe generatie ‘Frankenstein-muggen’ zou langer leven en zich snel genoeg voortplanten om normale soortgenoten te verdrijven.

Om dat te testen zetten de onderzoekers 1.200 gemodificeerde en eenzelfde aantal gewone muggen in een kooi met muizen die de plasmodium parasiet droegen. Langzaam, na negen generaties, bereikten de transgene insecten een dominantie van 70 procent.

Verspreiding van malariaresistente muggen in de natuur zou de ziekte kunnen uitbannen, denken de onderzoekers. Maar ze waarschuwen voor te veel optimisme. De plasmodium parasiet die muizen besmet is een andere dan de ziekteverspreider bij mensen, en de muizen kregen een hogere dosis dan normaal.

De mensheid bevrijden van malaria ?
Laat het maar niet horen aan ongenuanceerde milieuterroristen :
er is dan immers weer veel werk voor hen aan de winkel :
alweer biodiversiteit minder ( = oei , minder parasieten )
en ook nog eens genetische manipulatie !!(= oei , gevaarlijk risico )
Tsjonge
( Sarcasme )
Ach , ga toch niet een beetje klooien met de natuur …… Laat de natuur maar zelf iets in elkaar klooien …..zoals de mens bijvoorbeeld

‘Malariamug evolueert tot nieuwe soorten’

22 oktober 2010
© NU.nl/Dennis Rijnvis

– De meest gevaarlijke malariamug zal zich waarschijnlijk opsplitsen in twee verschillende soorten. Dat hebben Britse wetenschappers bekend gemaakt.

De genetische verschillen tussen twee stammen van de malariamug Anopheles gambiae worden zo groot dat er binnenkort waarschijnlijk sprake is van twee verschillende soorten. Dat melden de onderzoekers van het Imperial College in Londen in het wetenschappelijk tijdschrift Science.

Als de malariamug zich definitief opsplitst in twee soorten, wordt het moeilijker om nieuwe bestrijdingsmiddelen te ontwikkelen die muggen bijvoorbeeld onvruchtbaar maken

Ook zullen bestaande middelen door de snelle evolutie van de diertjes in de toekomst mogelijk minder goed werken, zo waarschuwen de onderzoekers.

Genetische analyse

“Strategieën die werken tegen de ene soort zullen straks mogelijk niet meer effectief zijn tegen de andere muggensoort”, verklaart hoofdonderzoekster Mara Lawniczak in de Britse krant The Guardian.

Het is al langer bekend dat de soort Anopheles gambiae uit twee verschillende stammen bestaat, genaamd M en S. De Britse onderzoekers hebben een gedetailleerde genetische analyse van de twee stammen uitgevoerd, die er op wijst dat ze veel meer van elkaar verschillen dan werd aangenomen.

“Deze mug werd altijd beschouwd als één soort”, aldus Lawniczak. “We hadden geen idee dat de stammen al zover op weg waren in het proces om twee verschillende soorten te worden.”

Doden

Malaria wordt veroorzaakt door een microscopische parasiet die wordt overgebracht door de beet van vrouwelijke muggen. Elk jaar raken 500 miljoen mensen besmet met malaria. Ongeveer twee miljoen patiënten overlijden jaarlijks als gevolg van de ziekte.

Volgens de Britse onderzoeker George Christophides is er meer genetisch onderzoek nodig om nieuwe bestrijdingsmiddelen tegen malaria te creëren.

“Dit soort studies helpen ons om de genetische samenstelling in kaart te brengen van de muggen die malaria verspreiden”, verklaart hij. “Uiteindelijk zullen we daardoor nieuwe manieren vinden om te voorkomen dat deze dieren mensen zullen infecteren.”

Trichromatisch zicht :
Transgene muizen zien regenboog
Eos
Amerikaanse onderzoekers gunden een paar genetisch gemodificeerde muizen het voorrecht als eersten van hun soort alle kleuren van de regenboog te zien.
De meeste zoogdieren, behalve de primaten en dus ook de mens, kunnen alleen blauwe, gele en grijze tinten waarnemen.
De wetenschappers voerden een kunstmatige mutatie (een klein deeltje menselijk DNA werd ingeplant )uit op het (vrouwelijke) X-chromosoom van de muizen, waardoor een derde soort fotopigment, een lichtgevoelige molecule in de retina geproduceerd werd.

http://scienceblogs.com/loom/2007/03/22/said_the_mouse_to_the_other_mo.php

Carl Zimmer :

…..Most mammals produce two kinds of pigments for catching light.

One is sensitive to short wavelength light (at the blue end of the spectrum). The other is sensitive to a longer wavelength, in the green or red part of the spectrum. Each pigment is encoded in a single gene, and any given photoreceptor in the retina uses only one. Each photoreceptor is most likely to fire a signal to the brain in response to a single wavelength of light. But it also has a smaller probability of firing off in response to photons of close wavelengths. By comparing all the signals coming from all the photoreceptors, a mammal can perceive a wide range of colors, rather than just seeing a world made up of green and blue pixels.

We humans–along with our closest primate relatives, the apes and the monkeys of Africa and Asia–can make three pigments, not two. We carry a gene for a blue pigment (S for short, at 420 nanometer wavelength), a green pigment (M for medium, 530 nm), and a red pigment (L for long, 560 nm).

This so-called trichromatic vision makes us a particularly good at making out different colors down at the yellow-to-red end of the spectrum. On the other hand, we don’t see up in the ultraviolet range, unlike many vertebrates.


Die molecule, die wij ook hebben, is gevoelig voor langere golflengten van licht — in het rode spectrum dus.
Uit kleurtesten bleek vervolgens dat de transgene muizen inderdaad alle tinten zoals wij die kennen, konden waarnemen.
Het experiment leert ons ook hoe de mens in de evolutie aan ‘kleurenzicht’ kwam.
Want, zodra de specifieke mutatie er is, blijkt het brein zich automatisch aan te passen, waardoor de signalen afkomstig van het derde, ‘rode’ fotopigment ook gezien worden.

Rijker kleurenpalet voor muizen  //23 maart 2007

Voor muizen bestaat de wereld uit vale grijze, blauwe en gele tinten. Maar met een simpele genetische aanpassing kunnen ze een hele regenboog aan verschillende kleuren onderscheiden.

Die ontdekking hebben wetenschappers van de Universiteit van Californi챘 gedaan. Zij implanteerden een klein deeltje menselijk DNA in het genoom van een muis. Om precies te zijn: ze gebruikten het deel van de menselijke genetische code dat ervoor zorgt dat we verschillende kleuren kunnen zien. En wat bleek? Ook de muis kan hiermee veel meer verschillende kleuren waarnemen. Blijkbaar zijn de hersenen van de kleine diertjes flexibel genoeg om deze aanpassing te verwerken en signalen op te pikken die normaal gesproken genegeerd worden.

Hoeveel kleuren een mens of dier kan zien, wordt grotendeels bepaald door de hoeveelheid verschillende soorten fotopigment dat in zijn of haar genen zit. De meeste zoogdieren kunnen slechts een beperkt aantal kleuren onderscheiden. Alleen mensen en veel apensoorten bezitten genoeg fotopigment om een breed palet aan kleuren te kunnen zien. Wetenschappers vragen zich al lange tijd af of een simpele toevoeging van extra fotopigment voldoende is om ‘kleurenblinde’ dieren meer kleuren te laten zien, of dat daar ook meer hersencapaciteit voor nodig is.

Proef op de som
De Amerikaanse wetenschappers namen de proef op de som door de genetische code van een aantal muizen dusdanig te veranderen, dat het op het gebied van kleuren zien dezelfde eigenschappen had als dat van een mens. Om erachter te komen of de muizen daadwerkelijk meer kleuren zagen, lieten ze hen een soort kleurenblind-test doen. De muizen kregen een serie verlichte knoppen voorgeschoteld. Telkens was er 챕챕n knop op een andere manier verlicht dan de rest. Als de muizen op de afwijkende knop drukten, kregen ze een lekkernij als beloning.De afwijkend verlichte knop was alleen te zien in een kleurenspectrum dat normaal gesproken alleen door mensen en bepaalde primaten kan worden waargenomen.

De genetisch gemanipuleerde muizen bleken echter ook in staat om deze kleuren te detecteren. Niet alle transgene muizen presteerden even goed. Volgens de wetenschappers komt dit wellicht doordat de combinatie van genen en fotopigment bij hen niet optimaal is. Maar in de andere gevallen bleek het aanpassen van het DNA dus voldoende te zijn om het kleurenspectrum van de diertjes flink te verbreden.

Ultraviolet
Leuk voor die muizen, maar heeft dit ook echt nut? Volgens de Amerikaanse wetenschappers gaat het in elk geval om een zeer belangrijke ontdekking. “Het is een opwindende gedachte dat de rest van het zenuwstelsel van de muis in staat blijkt te zijn om deze nieuwe informatie te verwerken.” Verder onderzoek moet nu uitwijzen of deze techniek ook bij andere diersoorten werkt. Mogelijk kunnen mensen in de toekomst via deze methode worden uitgerust met genen die hen in staat stellen om in het donker veel beter te kunnen zien, net als een uil. Of bijvoorbeeld om ultraviolette kleuren te kunnen zien, zoals ondermeer bijen dat kunnen.

De vraag blijft echter waarom de genen van de meeste zoogdieren niet uit zichzelf dusdanig ge챘volueerd zijn dat ze meer kleuren kunnen onderscheiden. Wellicht kleven er ook nadelen aan deze eigenschap. Hopelijk kan toekomstig onderzoek dit helder maken.

Links:

http://scienceblogs.com/loom/2007/03/22/said_the_mouse_to_the_other_mo.php

DEFENSINEN

Menseneiwit
bestrijdt plantenziekten
Een natuurlijk afweermiddel slaat een brug tussen mensen en dieren.
donderdag 22 maart 2007
EEN eiwit dat mensen beschermt tegen schimmelinfecties, kan ook ziekten bestrijden in gewijzigde planten, rapporteren Leuvense wetenschappers in het vakblad Plant Cell Reports.
Zowel planten als dieren bevatten kleine eiwitten die bacteri챘n en gisten kunnen doden. Die afweereiwitten of defensinen( http://en.wikipedia.org/wiki/Defensin)
zijn bij planten en dieren verschillend, maar toch is er enige gelijkenis die wijst op een verre gemeenschappelijke oorsprong.
Onderzoekster An Aerts en haar collega’s van de KU Leuven hebben aangetoond dat een afweereiwit van mensen, het b챔ta-defensine-2, ook effect heeft bij planten.
Bij mensen biedt het eiwit bescherming tegen onder meer de ziekenhuisbacterie (Staphylococcus aureus / http://nl.wikipedia.org/wiki/Staphylococcus_aureus) en tegen de vervelende schimmelinfectie
De onderzoekers van het Leuvense Centrum voor Microbi챘le en Plantengenetica hebben de genetische instructie (het gen) voor bèta-defensine-2 ingebouwd in het erfgoed van de kleine plant zandraket. (Arabidopsis)
De gewijzigde plant kon het eiwit produceren en bleek daardoor beter beschermd tegen de grauwe schimmel (Botrytis cinerea)http://nl.wikipedia.org/wiki/Grauwe_schimmel
een gevreesde ziekteverwekker bij planten.
,,Het menselijke defensine zou in theorie gebruikt kunnen worden om tomaten en aardbeien tegen de ziekte te beschermen, want Botrytis is
bij die teelten een veelvoorkomend probleem”
, zegt Isabelle Fran챌ois, die het onderzoek co철rdineerde.
,,Maar het is nog altijd niet eenvoudig gewijzigde planten op de markt te brengen, zeker als ze een gen bevatten afkomstig van dieren.
Het lijkt aanvaardbaarder om defensinen afkomstig uit planten in te bouwen.
Onze onderzoeksgroep heeft recent ook dergelijke plantdefensinen aangetoond die ook bescherming bieden tegen Botrytis.”
,,Wat de bevindingen over het menselijke defensine betreft, vinden we vooral het evolutionaire inzicht interessant, dat defensinen van mensen
ook bij planten actief kunnen zijn.”
( kidr)
p 11
artikel
ZIEK DOOR EEN    EVOLUTIONAIR VOORDEEL
De chronische huidziekte psoriasis is mogelijk de tol die sommige mensen betalen vooreen evolutionaire voorsprong: een sterkere afweer van de huid tegen bacteri챘n en andere micro-organismen. Deze stelling poneert prof. dr. Joost Schalkwijk, hoogleraar Experimentele Dermatologie, in de oratie die hij vandaag uitspreekt. Zijn onderzoeksgroep is momenteel druk bezig deze nieuwe kijk op ziekte wetenschappelijk te onderbouwen.
‘Mijn hypothese is dat de actieve afweer in de huid van mensen met psoriasis te goed werkt’
(uitreksel)


N a t u u r l i j k e   a n t i b i o t i c a

In zijn oratie poneert Schalkwijk een heel nieuwe kijk op het ontstaan van psoriasis: evolutionaire pech!

‘Om dat uit te leggen moeten we eerst terug naar een belangrijke functie van de huid’,steekt hij van wal. ‘De huid vormt een barrière van het lichaam tegen infecties door bacteriën en andere micro-organismen. Tot voor kort dachten we dat deze barrièrefunctie passief was. Enkele jaren geleden werd door verschillende onderzoeksgroepen, waaronderde onze, ontdekt dat de huid ook actief de strijd aangaat met micro-organismen. De huid is in staat kleine eiwitten aan temaken die een bacteriedodende werking hebben. Een soort van natuurlijke antibiotica. Huidcellen gaan deze eiwitten in verhoogde mate aanmaken zodra bacteriën en/of schimmels binden aan speciale receptoren op de huidcellen, de zogeheten toll-likereceptors, kortweg TLR’s. Het interessante is dat een van de antibiotica die de huid aanmaakt, het b챔ta-defensine-2, zelf ook bindt aan een TLR, waardoor de afweerreactie van de huidcellen zichzelfversterkt. Bovendien roept bèta-defensine-2 de hulp in vande systemische afweer: het lokt ontstekingscellen naar de huid om de bestrijding van de micro-organismen te ondersteunen.’

Genetische code

 zie onder Genetica

GENETISCHE CODE  <–(word)

http://whyevolutionistrue.wordpress.com/2013/02/07/happy-70th-birthday-this-week-genetic-code/

 

Genetische code

http://nl.wikipedia.org/wiki/Genetische_code

De genetische code is een tabel die aangeeft hoe tripletten van aangrenzende nucleotidenbasen (codons) worden vertaald naar aminozuren bij de biosynthese van eiwitten. Er zijn 64 (43) verschillende codons, die coderen voor 20 verschillende aminozuren; voor veel van de aminozuren zijn dus meerdere verschillende codons.
De DNA-basen van een gen worden eerst vertaald naar een molecuul messenger-RNA (mRNA) (transcriptie). Bepaalde delen van het mRNA, de introns, worden daarna weggeknipt, en daarna worden aminozuren aan elkaar vastgekoppeld bij de translatie in het ribosoom. Sommige codons hebben geen aminozuurequivalent; wordt zo’n codon gelezen dan eindigt de translatie. Ze worden daarom stopcodons genoemd.

Vrijwel alle levende wezens gebruiken dezelfde genetische code. De volgende tabel geeft de standaardversie. (U staat voor Uracil in het RNA; in het DNA zou hiervoor een T van Thymine staan).

Tabel 1 : Codon tabel. Deze tabel geeft de 64 (43) mogelijke codontripletten.
2e base
U C A G
1e base U UUU Fenylalanine
UUC Fenylalanine
UUA Leucine
UUG Leucine
UCU Serine
UCC Serine
UCA Serine
UCG Serine
UAU Tyrosine
UAC Tyrosine
UAA Stop
UAG Stop
UGU Cysteine
UGC Cysteine
UGA Stop
UGG Tryptofaan
C CUU Leucine
CUC Leucine
CUA Leucine
CUG Leucine
CCU Proline
CCC Proline
CCA Proline
CCG Proline
CAU Histidine
CAC Histidine
CAA Glutamine
CAG Glutamine
CGU Arginine
CGC Arginine
CGA Arginine
CGG Arginine
A AUU Isoleucine
AUC Isoleucine
AUA Isoleucine
AUG Methionine1
ACU Threonine
ACC Threonine
ACA Threonine
ACG Threonine
AAU Asparagine
AAC Asparagine
AAA Lysine
AAG Lysine
AGU Serine
AGC Serine
AGA Arginine
AGG Arginine
G GUU Valine
GUC Valine
GUA Valine
GUG Valine
GCU Alanine
GCC Alanine
GCA Alanine
GCG Alanine
GAU Asparaginezuur
GAC Asparaginezuur
GAA Glutaminezuur
GAG Glutaminezuur
GGU Glycine
GGC Glycine
GGA Glycine
GGG Glycine

1Het AUG codon codeert voor methionine en dient tevens als startpunt; de eerste AUG in een mRNA is de plaats waar de translatie begint.

Tabel 2 : Inverse codon tabel. Deze toont de 20 aminozuren en de codons waardoor ze kunnen worden gecodeerd.
Ala GCU, GCC, GCA, GCG Leu UUA, UUG, CUU, CUC, CUA, CUG
Arg CGU, CGC, CGA, CGG, AGA, AGG Lys AAA, AAG
Asn AAU, AAC Met AUG
Asp GAU, GAC Phe UUU, UUC
Cys UGU, UGC Pro CCU, CCC, CCA, CCG
Gln CAA, CAG Ser UCU, UCC, UCA, UCG, AGU, AGC
Glu GAA, GAG Thr ACU, ACC, ACA, ACG
Gly GGU, GGC, GGA, GGG Trp UGG
His CAU, CAC Tyr UAU, UAC
Ile AUU, AUC, AUA Val GUU, GUC, GUA, GUG
START AUG, GUG STOP UAG, UGA, UAA

A=Adenine, C=Cytosine, T=Thymine, G=Guanine en U=Uracil

Externe links

zie ook —>GENETISCHE CODE

GENETIC CODE( J. Mol. Evol., 59:1 – 8 (2004) )A new classification scheme of genetic code is based on a binary representation of :

  • purines (G,A) – 1
  • pyrimidines (C,U) – 0

The eight rows (23 = 8) and four columns are sufficient to place 20 amino acids, as well as the termination codons.

Code 6 hydrogen bonds 5 hydrogen bonds 5 hydrogen bonds 4 hydrogen bonds
000 Pro CC (C/U) PProline Ser UC (C/U) SSerine Leu CU (C/U) LLeucine Phe UU (C/U) FPhenylalanine
001 Pro CC (A/G) PProline Ser UC (A/G) SSerine Leu CU (A/G) LLeucine Leu UU (A/G) LLeucine
100 Ala GC (C/U) AAlanine Thr AC (C/U) TThreonine Val GU (C/U) VValine Ile AU (C/U) IIsoleucine
101 Ala GC (A/G) AAlanine <v: Thr AC (A/G) TThreonine Val GU (A/G) VValine Ile/Met AU (A/G) I/MIsoleucine / Methionine
010 Arg CG (C/U) RArginine Cys UG (C/U) CCysteine His CA (C/U) HHistidine Tyr UA (C/U) YTyrosine
011 Arg CG (A/G) RArginine Stop/Trp UG (A/G) WTryptophan Gln CA (A/G) QGlutamine Stop UA (A/G) *
101 Ala GC (A/G) AAlanine <v: Thr AC (A/G) TThreonine Val GU (A/G) VValine Ile/Met AU (A/G) I/MIsoleucine / Methionine
010 Arg CG (C/U) RArginine Cys UG (C/U) CCysteine His CA (C/U) HHistidine Tyr UA (C/U) YTyrosine
011 Arg CG (A/G) RArginine Stop/Trp UG (A/G) WTryptophan Gln CA (A/G) QGlutamine Stop UA (A/G) *
110 Gly GG (C/U) GGlycine Ser AG (C/U) SSerine Asp GA (C/U) DAspartic acid Asn AA (C/U) NAsparagine
111 Gly GG (A/G) GGlycine Arg AG (A/G) RArginine Glu GA (A/G) EGlutamic acid Lys AA (A/G) KLysine
  1. Each row contains exactly 4 different amino acids (including the termination codon).In the standard code, exceptions are the second row with two leucines and in the fourth row the AU* start codon. Note that here are also the deviations from the standard code. Interestingly, the yeast mitochondrial code shows no exception: each row contains exactly four different entries in four different columns. In this spirit the yeast mitochondrial code is the most regular one.
  2. The mitochondrial code shows no exception: 32 positions contain exactly 32 entries.
  3. There are 22 tRNA genes in the mammalian mitochondrial genomes: Table2.The mammalian mitochondrial genomes contain ONE gene for each tRNA, with the exceptions of tRNA Leucine and tRNA Serine for which TWO genes are present.” This is no exeption for our scheme, what can be seen in the mammalian mitochondrial code via tRNA .
  4. This corresponds to the known fact that transition mutations (e.g. purine A vs. purine G) occur more frequently than transversion mutations (e.g. purine A vs. pyrimidine U).Our scheme yields some support for the “adaptive genetic code” hypothesis (Freeland 2002) which states that the code has evolved to minimize the deleterious effects of mutation and translation error (Haig and Hurst 1991, Freeland and Hurst 1998). The purine-pyrimidine binary coding scheme, given intable, gives a much higher regularity than a binary coding according to the base pairs (A,U – 1; G,C – 0).
  5. In the first column the first two positions are G and C. These always pair with their anticodon base via 3 hydrogen bonds, i.e. the first two bases together always guarantee 6 hydrogen bonds. For that reason Lagerkvist (1978) called them strong codons. In the second and third column, the first two bases guarantee exactly 5 bonds (mixed codons) and in the fourth column just 4 bonds (weak codons).This pattern corresponds very well to the importance of the third base in the triplet codon: if the first bases are G and/or C (first column), the third base is never important, and in the second and third column, the third base is important in exactly half of the cases (if there is a purine in the second position – lower half of the table). In the fourth column the third base is always necessary for the determination of the correct amino acid.
  6. The deviations of non-standard genetic codes. As can be seen in table, nearly all deviations occur in codons with a purine at the third position. The only exception is the yeast mitochondrial code where CU* does not code for Leu, but rather for Thr.
  7. Two perfect symmetries in our scheme.The first is the codon-anticodon symmetry: the thick horizontal line in Fig.2 marks the symmetry axis.
    For instance, codon CCC (Pro, first column, first row) has the anticodon GGG (Gly, first column, last row).

    The second is the point symmetry corresponding to Halitsky’s family – nonfamily symmetry operation (“E-M bifurcation”, Halitsky 2003),
    indicated by the point in the center of
    table. Halitsky observed that all the 32 “family codons” CC*, CU*, UC* GC*, GU*, AC*, CG*, GG* can be mapped into the 32 “nonfamily codons” UU*, AU*, CA*, UG*, UA*, GA*, AG*, AA* by exchanging the two amino bases A and C with one another, and the two keto bases U and G with one another. For instance, the family codon GUA (Val) is mapped into the nonfamily codon UGC (Cys). Thus, this point symmetry is behind the family – nonfamily symmetry in our scheme (shaded vs. unshaded regions).
  8. In the fourth column all amino acids are ketogenic (leucine, lysine) or glucogenic and ketogenic (isoleucine, phenylalanine, threonine, asparagine, methionine and tyrosine) .The carbon skeletons of amino acids are generally conserved as carbohydrate, via gluconeogenesis, or as fatty acid via fatty acid synthesis pathways. In this respect amino acids fall into three categories:glucogenic, ketogenic, or glucogenic and ketogenic.Glucogenic amino acids are those that give rise to a net production of pyruvate or TCA cycle intermediates, such as a-ketoglutarate or oxaloacetate, all of which are precursors to glucose via gluconeogenesis.
  9. Correlation of codon strength and amino acid properties: Table 1.
  10. Evolution of the genetic code: doublet code?

http://www.evolvingcode.net/index.php?page=Universal_Genetic_Code

against creationist misinformation
Historical adres
TTAGGG sequentie
Unieke individuele eigenschappen en de TTAGGG sequentie op de menselijke telomeren
Ieder individu reageert anders op geneesmiddelen, voeding en omgevingsstoffen, net zoals op micro-organismen.
In onze 3 miljard DNA-nucleotides zitten een 22.000 genen, die tot honderdduizenden eiwitproducten kunnen leiden.
In ieder van onze 100 biljoen cellen is de onderlinge verhouding van deze eiwitten ook weer anders; geen enkele cel is gelijk; net als individuen nooit gelijk zijn ( zelfs eeneiige tweelingen niet ) .
Veranderingen op DNA-niveau kunnen leiden tot veranderingen op RNA- en eiwitniveau.
Denk hierbij niet alleen aan punt-mutaties, maar ook aan volledige deleties, alternatieve manieren om de exonen in het mRNA te koppelen bij het weghalen( uitsnijden ) van de intronen, frame shifts, repeats en andere complexe zaken.
Alles wat fout kan gaan, is fout gegaan.
Het enige dat echt bewaard is gebleven is de TTAGGG sequentie die aan de staart van de chromosomen (telomeren) zit.
TTAGGG is een menselijke telomeer-sequentie van een basis -sequentie die bij alle (aardse )levende wezens aanwezig is (zie tabel onder ) :

Telomeer <

Een telomeer bestaat uit enkelstrengs DNA en zit aan het uiteinde van een chromosoom. Telomeer betekent in het Grieks eindstuk. Een telomeer komt niet voor bij prokaryoten met een ringvormig chromosoom.

Oude cellen hebben chromosomen met een korter telomeer dan jonge cellen. Een uitzondering hierop werd echter in 2003 ontdekt bij het Vaal stormvogeltje, waarbij de telomeren bij het ouder worden van de vogel juist in lengte toenemen.

Een telomeer is te vergelijken met het plastic uiteinde van een veter. Bij iedere deling rafelt het uiteinde een stukje uit en uiteindelijk kan de cel niet meer delen en sterft. Menselijke cellen bereiken dit stadium na zo’n vijftig, zestig delingen.

Als de telomeerlengte behouden blijft, kan de cel zich blijven delen zonder dood te gaan. Onder de microscoop is een telomeer zichtbaar als een oplichtend puntje.

T-loop

Een telomeer bestaat uit repeterende stukjes DNA dat de belangrijke genen beschermt tegen het korter worden van de chromosomen. Ook is het telomeer belangrijk voor de stabiliteit van het chromosoom. Bij de mens bestaat het repeterende stukje DNA uit de sequentie TTAGGG en is het telomeer tussen de 3 en 20 kilobasen lang. Tussen het telomeer en de rest van het chromosoom zit nog een stukje dat 100 tot 300 kilobasen lang is. Hierdoor kan het telomeer een soort lasso, T-loop, vormen. De sequentie verschilt per organisme, maar bevat gewoonlijk veel GC (Guanine en Cytosine) nucleotiden.

Telomerase

Tijdens de celdeling wordt het DNA via replicatie verdubbeld. Het enzym DNA-polymerase kan echter het eind van het chromosoom niet repliceren, omdat het voortijdig van het DNA afvalt. Hierdoor worden bij elke celdeling de chromosomen korter. Het enzym telomerase dat een reverse-transcriptase is, kan een telomeer weer langer maken en komt voor in de kiembaancellen die de geslachtscellen maken, stamcellen, kankercellen en protozoa. Telomerase bestaat uit een enzymatisch deel en een RNA deel, de complementaire sequentie.

Verantwoordelijk gen

Het gen dat verantwoordelijk is voor de vorming van telomerase is in 1998 door Geron Corporation in Californië gekloond en ingebracht in cellen. Deze cellen hebben zich twee jaar lang gedeeld zonder enige vorm van veroudering. Ze lijken onsterfelijk te zijn geworden.

DNA-herstelmechanisme

Elke cel beschikt over een DNA-herstelmechanisme dat beschadigd DNA repareert. Als het DNA te veel beschadigd is en niet meer hersteld kan worden, stopt de cel met delen of gaat dood. Als het telomeer 4 kilobasen kort is geworden kan het geen lus meer maken en ziet het DNA-herstelmechanisme het eind van het chromosoom als een gebroken chromosoom waardoor de cel stopt met delen of dood gaat.

Klonen

Bij klonen van cellen vertrekt men van cellen die al kortere telomeren hebben. Het nieuw organisme vertrekt dus met kortere telomeren.

Enkele bekende telomeren sequenties
Groep Organisme Telomeer repeterend stukje DNA (repeat) (5′ → 3′ richting eind)
Gewervelden Mens, muis, Xenopus TTAGGG
Draadvormende schimmels Neurospora crassa TTAGGG
Slijmzwammen Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastiden protozoa Trypanosoma, Crithidia TTAGGG
Ciliophora (protozoa) Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexan (protozoa) Plasmodium TTAGGG(T/C)
Hogere planten Arabidopsis thaliana TTTAGGG
Groene algen Chlamydomonas TTTTAGGG
Insecten Bombyx mori TTAGG
Rondwormen Ascaris lumbricoides TTAGGC
Celdelende gisten Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Knopvormende gisten Saccharomyces cerevisiaeCandida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis
TGTGGGTGTGGTG (van RNA ‘mal’ (template))of G(2-3)(TG)(1-6)T (consensus)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT
Over de evolutie van de genetische code
op januari 2, 2012

Eerst gaat het vaak over de abiogenesis, ofwel het ontstaan van de eerste macromoleculen (DNA, RNA en eiwitten) uit de beschikbare moleculen in de ‘primordiale soep’. Daarbij springt vooral het werk van Ernesto Di Mauro (1, 2) in het oog, die liet zien dat zich in water zonder katalyserende enzymen spontaan lange ketens van nucleotiden (ofwel basen) kunnen vormen. In zijn experimenten ging het om heel eenvoudige ketens van maar één van de vier basen.

Genetische code

De genetische code: A, G, C en U zijn de vier basen van het RNA die de drieletterig code vormen voor de aminozuren (aangegeven met kleine letters)

Nucleotiden ofwel basen zijn de letters van het DNA en het RNA. DNA kent iedereen als de moleculen waarin onze genen opgeslagen liggen. De genen worden gelezen en zo wordt er in de celkern mRNA van gemaakt dat een bijna exacte kopie is van het DNA. Het DNA en het RNA bestaan uit vier verschillende letters (A, G, C en T of U). Bij de productie van eiwitten, wordt het mRNA afgelezen waarbij de letters in groepjes van drie worden herkend door het transferRNA ofwel het tRNA. Die groepjes van drie zijn de codons. Deze zijn complementair aan een tRNA dat een specifiek aminozuur draagt. Aangezien we vier ‘letters’ hebben die zich in groepjes van drie kunnen combineren, bestaan er 4^3 = 64 verschillende codons. De eiwitten, die uit ketens van aminozuren bestaan, zijn uit slechts 20 verschillende aminozuren opgebouwd. In de tabel zijn de codons met hun corresponderende aminozuren te zien; dit is de genetische code. Het blijkt dat de code voor elk aminozuur voornamelijk bepaald wordt door de eerste twee letters. De derde is vaak irrelevant. Deze derde positie wordt ook wel de Wobble positie genoemd en de code zelf is zogezegd gedegenereerd. Het gangbare idee is dat de oorspronkelijke primordiale code slechts uit twee nucleotiden bestond en dat daar vervolgens een code van drie basen uit ontstaan is.

Translatie

Fig. 1 Translatie: Het tRNA hecht zich met het anti-codon aan het codon van het mRNA (groen). Het gedragen aminozuur wordt vastgehecht aan de groeiende peptide.

Een belangrijke rol heeft het tRNA. Dit tRNA heeft een arm waarvan het uiteinde van de lus complementair is aan het codon van het mRNA. Het tRNA, dat een specifiek aminozuur draagt, hecht zich met zijn anti-codon aan het mRNA zodra ‘zijn’ codon aan de beurt is om vertaald te worden (zie fig. 1). Het aminozuur hecht zich aan de keten aminozuren en is daarmee deel van het groeiende eiwit. De code is gedegenereerd wat betekent dat er verschillende tRNA’s zijn die hetzelfde aminozuur dragen.

De allerbelangrijkste speler is wel de synthase van het tRNA. Dit enzym is verantwoordelijk voor de juiste koppeling van een tRNA aan het bijbehorende aminozuur (zie fig.2) . Het is de ware tweetalige protagonist die de brug legt tussen de vier lettercode van het DNA/RNA en de twintig lettercode van de eiwitten. Hier is een filmpje te zien van hoe dat in zijn werk gaat. Een kant van het enzym leest het anti-codon en de andere kant hecht het juiste aminozuur aan het andere uiteinde van het tRNA. Elk aminozuur heeft zijn eigen tRNA-synthase.

tRNA synthase

Fig. 2. tRNA synthase (geel), tRNA (rood)

Er bestaan twee groepen tRNA-synthase. Elke groep bestaat uit 10 enzymen. De twee groepen verschillen van elkaar voor wat betreft hun actieve site, hun sequentie, en de plek waar het aminozuur vastgemaakt wordt. Op dezelfde manier kunnen de aminozuren in twee groepen verdeeld worden. Dit heeft geleid tot het idee dat de twee groepen apart van elkaar geëvolueerd zijn of zelfs na elkaar. Het zou kunnen dat er ooit twee codes naast elkaar bestonden en dat deze twee zich samengevoegd hebben. Het zou ook kunnen dat er in eerste instantie heel eenvoudige eiwitten bestaan hebben van slechts 10 aminozuren (groep II) in plaats van 20. Studies van sterk geconserveerde sequenties, die dus erg oud zijn, tonen aan dat deze voornamelijk uit groep II-aminozuren zijn opgebouwd. Deze primordiale verdubbeling van de genetische code laat zien dat de code niet eenvoudigweg een ‘bevroren toeval’ is zoals Crick beweerde, maar wel degelijk een optimale code is. Uit: Apoorva Patel (2004);Woese et al. (2000);José et al. (2009)

WOBBLE POSITIE : De derde codonpositie is vaak niet relevant. waarom er dan nog 64 codons moeten bestaan ? Veel overlap ?Redundantie ? “vaak ” in de bovenstaande zin , moet genuanceerder zijn : ….immers : ‘De 3de base(letter) ___De”wobble” positie ___ is wél relevant bij aminozuren die maar door 1,2 of 3 codons worden gecodeerd en is niet relevant bij aminozuren die door 4 codons worden, gecodeerd.’ –*De 64 codons zijn simpelweg het gevolg van het feit dat een codon uit 3 basen bestaat. Daar volgen dus 4^3 = 64 (mogelijke combinaties ) codons uit. Deze zogenoemde “degenererende “eigenschap ( met als resultaat een mogelijke “overbodige (=redundante )” overlap “) manifesteert zich op niveau van de aminozuren waarvan er slechts 20 zijn voor 64 codons. -In zekere zin is het toch wat speciaal dat er tegenwoordig 64 codons in omloop zijn ....want er wordt serieus gespeculeerd over het feit dat de (oudste) code ooit uit twee basen bestond i.p.v. drie. Je spreekt in die optie dan alleen niet van “degenereren ” omdat de code van twee naar drie basen zou gegaan zijn. Enig idee waarom die code van 2 naar 3 ging terwijl er een hoop wobbles zijn?
-Het waarom is lastig. Als je zoals Apoorva Patel ervan uitgaat dat er aan het begin van het leven twee codes bestonden met codons van twee basen dan levert dat 2 x 4^2= 2 x 16 aminozuren. Meer dan genoeg voor de twintig die we kennen. Dus een codon van twee nucleotiden omdat het ‘simpeler’ was?
De derde nucleotide of base had absoluut geen rol. Maar hij zat er dus wel. Dit alles is gebaseerd op het feit dat de tRNA’s van twee klassen zijn. Elke klasse draagt 10 verschillende aminozuren.
Het anticodon van tRNA heeft drie nucleotiden/basen
. Er wordt wel beweerd dat de kromming in de ‘loop’ van het anticodon ervoor zorgt dat de derde base niet hoeft te matchen.

NOTES  G 

NoteDE GENETISCHE CODE 

In DNA vormen de nucleotide basen een eenvoudig vierletter alfabet dat kan coderen voor de 20 aminozuren die voorkomen in eiwitten.
De taal van de genetische code ligt bevat in codonen, woorden voor individuele aminozuren.
Elk codon is exact drie basen lang.
Een gen kan voorgesteld worden als een zin die volledig is samengesteld met deze drie letterwoorden. Op het eerste zicht kan dit alfabet te beperkt lijken.
Maar als de vier letters in combinaties van drie worden gebruikt, zijn er 64 verschillende combinaties mogelijk.
Inderdaad, vele aminozuren kunnen beschreven worden met meer dan één codon.
Het basismechanisme van de genetische code is vergelijkbaar bij vele organismen.Omwille van deze gelijkenis, is het soms mogelijk om een DNA segment van één bron te nemen en hetzelfde gedrag bij een andere te voorspellen.
Een DNA segment kan bijvoorbeeld ingebracht worden in een gastheerorganisme, zoals een bacterie, waardoor de bacteriën het menselijk eiwit zullen produceren.
Dit is de sleutel voor genetic engineering.http://nl.wikipedia.org/wiki/Genetische_codeet een vier-letter code kunnen 64 verschillende combinaties van elk drie letters worden gemaakt, die de bouwstenen voor de eiwitten coderen –
de aminozuren.
Omdat er maar 20 verschillende aminozuren in eiwitten voorkomen en er 64 combinaties mogelijk zijn, zijn er 44 combinaties over.
Drie daarvan worden gebruikt als stopsignalen (1a) die de moleculaire machientjes vertellen wanneer het eiwit klaar is, maar welke functies zouden de
resterende 41 combinaties kunnen vervullen?
Het blijkt dat ze ook gewoon coderen voor één van de 20 aminozuren.
Sommige aminozuren worden namelijk door verschillende combinaties gecodeerd.(1b)De aminozuren serine, arginine en leucine worden bijvoorbeeld op zes verschillende manieren gecodeerd.
Vijf andere aminozuren – alanine, glycine, proline, threonine en valine – worden door vier codes gespecificeerd.
De overige aminozuren worden door één, twee of drie codes gespecificeerd.
Vijf komt niet voor.OPMERKINGEN :
Bron : blog van een creationist =
http://www.vkblog.nl/bericht/268733/Nogmaals_voor_dovemansoren
( Lees vooral het commentaar van Peter Mudde )

Volgens intelligent Design aanhangers is deze hierboven (kort) beschreven code de ” slimste ” oplossing …

Maar er zijn wel degelijk slimmere oplossingen te bedenken.
Je kunt een mutatiebestendige code bedenken, een extra controlesysteem …(2)

Een code b.v. die bestaat uit een drie maal herhaald triplet..
Je hebt dan negen baseparen per aminozuur nodig, maar als je vervolgens in je systeem inbouwt dat als er van de drie tripletten er 1 afwijkt,
die weer hetzelfde gemaakt wordt als de twee andere tripletten, ben je bijna foutbestendig.
Je kunt ook eiwitten opbouwen uit minder dan 20 aminozuren zonder dat ze noemenswaard in werking achteruit gaan

De bewering
“Omdat er maar 20 verschillende aminozuren in eiwitten voorkomen .. tot… Elke andere andere verdeling is slechter.”
is weinig steekhoudend.
Het klinkt mooi, maar waarom zou elke andere verdeling slechter zijn?

Het is ook maar hoe je het brengt..
Sommige aminozuren worden gecodeerd niet door drie, maar door slechts de eerste twee basenparen van een triplet..
Het derde paar hangt er voor spek en bonen bij..

-De derde positie ( =het derde basenpaar ) __door Peter Mudde terecht “Het derde paar hangt er ( soms ) voor spek en bonen bij..”, genoemd ___
is het zogenaamde “wobble” paar … toch ?
(Las ik bij de leuvense geneticus prof . Cassiman )

NOTEN
(1)
a) naast de “stop-codons ” is er slechts één “start ” codon ( AUG-codon )
–> zie http://nl.wikipedia.org/wiki/Methionine

b) Het feit dat verschillende codons coderen voor dezelfde basisbouwstoffen ( pakweg 20 aminozuren )
“degenerancy” van de genetische code genoemd …
Zie hier een aanklikbare link die over dit onderwerp gaat
arxiv.org/ftp/math/papers/0607…

(2)
alleen heb je dan geen bron van mutaties meer die het genetische “ontwerp” van een bestaand organisme in zijn afstammingslijnen laat “adapteren”aan
het veranderend millieu en het daardoor vroeg of laat tot uitsterven doemt ..
= Het is dan ook niet nodig (of erg slim ) dat zulke systemen zich(altijd) vermenigvuldigen als ze dan toch gedoemd zijn tot uitsterven …