Genetische code


 zie onder Genetica

GENETISCHE CODE  <–(word)

http://whyevolutionistrue.wordpress.com/2013/02/07/happy-70th-birthday-this-week-genetic-code/

 

Genetische code

http://nl.wikipedia.org/wiki/Genetische_code

De genetische code is een tabel die aangeeft hoe tripletten van aangrenzende nucleotidenbasen (codons) worden vertaald naar aminozuren bij de biosynthese van eiwitten. Er zijn 64 (43) verschillende codons, die coderen voor 20 verschillende aminozuren; voor veel van de aminozuren zijn dus meerdere verschillende codons.
De DNA-basen van een gen worden eerst vertaald naar een molecuul messenger-RNA (mRNA) (transcriptie). Bepaalde delen van het mRNA, de introns, worden daarna weggeknipt, en daarna worden aminozuren aan elkaar vastgekoppeld bij de translatie in het ribosoom. Sommige codons hebben geen aminozuurequivalent; wordt zo’n codon gelezen dan eindigt de translatie. Ze worden daarom stopcodons genoemd.

Vrijwel alle levende wezens gebruiken dezelfde genetische code. De volgende tabel geeft de standaardversie. (U staat voor Uracil in het RNA; in het DNA zou hiervoor een T van Thymine staan).

Tabel 1 : Codon tabel. Deze tabel geeft de 64 (43) mogelijke codontripletten.
2e base
U C A G
1e base U UUU Fenylalanine
UUC Fenylalanine
UUA Leucine
UUG Leucine
UCU Serine
UCC Serine
UCA Serine
UCG Serine
UAU Tyrosine
UAC Tyrosine
UAA Stop
UAG Stop
UGU Cysteine
UGC Cysteine
UGA Stop
UGG Tryptofaan
C CUU Leucine
CUC Leucine
CUA Leucine
CUG Leucine
CCU Proline
CCC Proline
CCA Proline
CCG Proline
CAU Histidine
CAC Histidine
CAA Glutamine
CAG Glutamine
CGU Arginine
CGC Arginine
CGA Arginine
CGG Arginine
A AUU Isoleucine
AUC Isoleucine
AUA Isoleucine
AUG Methionine1
ACU Threonine
ACC Threonine
ACA Threonine
ACG Threonine
AAU Asparagine
AAC Asparagine
AAA Lysine
AAG Lysine
AGU Serine
AGC Serine
AGA Arginine
AGG Arginine
G GUU Valine
GUC Valine
GUA Valine
GUG Valine
GCU Alanine
GCC Alanine
GCA Alanine
GCG Alanine
GAU Asparaginezuur
GAC Asparaginezuur
GAA Glutaminezuur
GAG Glutaminezuur
GGU Glycine
GGC Glycine
GGA Glycine
GGG Glycine

1Het AUG codon codeert voor methionine en dient tevens als startpunt; de eerste AUG in een mRNA is de plaats waar de translatie begint.

Tabel 2 : Inverse codon tabel. Deze toont de 20 aminozuren en de codons waardoor ze kunnen worden gecodeerd.
Ala GCU, GCC, GCA, GCG Leu UUA, UUG, CUU, CUC, CUA, CUG
Arg CGU, CGC, CGA, CGG, AGA, AGG Lys AAA, AAG
Asn AAU, AAC Met AUG
Asp GAU, GAC Phe UUU, UUC
Cys UGU, UGC Pro CCU, CCC, CCA, CCG
Gln CAA, CAG Ser UCU, UCC, UCA, UCG, AGU, AGC
Glu GAA, GAG Thr ACU, ACC, ACA, ACG
Gly GGU, GGC, GGA, GGG Trp UGG
His CAU, CAC Tyr UAU, UAC
Ile AUU, AUC, AUA Val GUU, GUC, GUA, GUG
START AUG, GUG STOP UAG, UGA, UAA

A=Adenine, C=Cytosine, T=Thymine, G=Guanine en U=Uracil

Externe links

zie ook —>GENETISCHE CODE

GENETIC CODE( J. Mol. Evol., 59:1 – 8 (2004) )A new classification scheme of genetic code is based on a binary representation of :

  • purines (G,A) – 1
  • pyrimidines (C,U) – 0

The eight rows (23 = 8) and four columns are sufficient to place 20 amino acids, as well as the termination codons.

Code 6 hydrogen bonds 5 hydrogen bonds 5 hydrogen bonds 4 hydrogen bonds
000 Pro CC (C/U) PProline Ser UC (C/U) SSerine Leu CU (C/U) LLeucine Phe UU (C/U) FPhenylalanine
001 Pro CC (A/G) PProline Ser UC (A/G) SSerine Leu CU (A/G) LLeucine Leu UU (A/G) LLeucine
100 Ala GC (C/U) AAlanine Thr AC (C/U) TThreonine Val GU (C/U) VValine Ile AU (C/U) IIsoleucine
101 Ala GC (A/G) AAlanine <v: Thr AC (A/G) TThreonine Val GU (A/G) VValine Ile/Met AU (A/G) I/MIsoleucine / Methionine
010 Arg CG (C/U) RArginine Cys UG (C/U) CCysteine His CA (C/U) HHistidine Tyr UA (C/U) YTyrosine
011 Arg CG (A/G) RArginine Stop/Trp UG (A/G) WTryptophan Gln CA (A/G) QGlutamine Stop UA (A/G) *
101 Ala GC (A/G) AAlanine <v: Thr AC (A/G) TThreonine Val GU (A/G) VValine Ile/Met AU (A/G) I/MIsoleucine / Methionine
010 Arg CG (C/U) RArginine Cys UG (C/U) CCysteine His CA (C/U) HHistidine Tyr UA (C/U) YTyrosine
011 Arg CG (A/G) RArginine Stop/Trp UG (A/G) WTryptophan Gln CA (A/G) QGlutamine Stop UA (A/G) *
110 Gly GG (C/U) GGlycine Ser AG (C/U) SSerine Asp GA (C/U) DAspartic acid Asn AA (C/U) NAsparagine
111 Gly GG (A/G) GGlycine Arg AG (A/G) RArginine Glu GA (A/G) EGlutamic acid Lys AA (A/G) KLysine
  1. Each row contains exactly 4 different amino acids (including the termination codon).In the standard code, exceptions are the second row with two leucines and in the fourth row the AU* start codon. Note that here are also the deviations from the standard code. Interestingly, the yeast mitochondrial code shows no exception: each row contains exactly four different entries in four different columns. In this spirit the yeast mitochondrial code is the most regular one.
  2. The mitochondrial code shows no exception: 32 positions contain exactly 32 entries.
  3. There are 22 tRNA genes in the mammalian mitochondrial genomes: Table2.The mammalian mitochondrial genomes contain ONE gene for each tRNA, with the exceptions of tRNA Leucine and tRNA Serine for which TWO genes are present.” This is no exeption for our scheme, what can be seen in the mammalian mitochondrial code via tRNA .
  4. This corresponds to the known fact that transition mutations (e.g. purine A vs. purine G) occur more frequently than transversion mutations (e.g. purine A vs. pyrimidine U).Our scheme yields some support for the “adaptive genetic code” hypothesis (Freeland 2002) which states that the code has evolved to minimize the deleterious effects of mutation and translation error (Haig and Hurst 1991, Freeland and Hurst 1998). The purine-pyrimidine binary coding scheme, given intable, gives a much higher regularity than a binary coding according to the base pairs (A,U – 1; G,C – 0).
  5. In the first column the first two positions are G and C. These always pair with their anticodon base via 3 hydrogen bonds, i.e. the first two bases together always guarantee 6 hydrogen bonds. For that reason Lagerkvist (1978) called them strong codons. In the second and third column, the first two bases guarantee exactly 5 bonds (mixed codons) and in the fourth column just 4 bonds (weak codons).This pattern corresponds very well to the importance of the third base in the triplet codon: if the first bases are G and/or C (first column), the third base is never important, and in the second and third column, the third base is important in exactly half of the cases (if there is a purine in the second position – lower half of the table). In the fourth column the third base is always necessary for the determination of the correct amino acid.
  6. The deviations of non-standard genetic codes. As can be seen in table, nearly all deviations occur in codons with a purine at the third position. The only exception is the yeast mitochondrial code where CU* does not code for Leu, but rather for Thr.
  7. Two perfect symmetries in our scheme.The first is the codon-anticodon symmetry: the thick horizontal line in Fig.2 marks the symmetry axis.
    For instance, codon CCC (Pro, first column, first row) has the anticodon GGG (Gly, first column, last row).

    The second is the point symmetry corresponding to Halitsky’s family – nonfamily symmetry operation (“E-M bifurcation”, Halitsky 2003),
    indicated by the point in the center of
    table. Halitsky observed that all the 32 “family codons” CC*, CU*, UC* GC*, GU*, AC*, CG*, GG* can be mapped into the 32 “nonfamily codons” UU*, AU*, CA*, UG*, UA*, GA*, AG*, AA* by exchanging the two amino bases A and C with one another, and the two keto bases U and G with one another. For instance, the family codon GUA (Val) is mapped into the nonfamily codon UGC (Cys). Thus, this point symmetry is behind the family – nonfamily symmetry in our scheme (shaded vs. unshaded regions).
  8. In the fourth column all amino acids are ketogenic (leucine, lysine) or glucogenic and ketogenic (isoleucine, phenylalanine, threonine, asparagine, methionine and tyrosine) .The carbon skeletons of amino acids are generally conserved as carbohydrate, via gluconeogenesis, or as fatty acid via fatty acid synthesis pathways. In this respect amino acids fall into three categories:glucogenic, ketogenic, or glucogenic and ketogenic.Glucogenic amino acids are those that give rise to a net production of pyruvate or TCA cycle intermediates, such as a-ketoglutarate or oxaloacetate, all of which are precursors to glucose via gluconeogenesis.
  9. Correlation of codon strength and amino acid properties: Table 1.
  10. Evolution of the genetic code: doublet code?

http://www.evolvingcode.net/index.php?page=Universal_Genetic_Code

against creationist misinformation
Historical adres
TTAGGG sequentie
Unieke individuele eigenschappen en de TTAGGG sequentie op de menselijke telomeren
Ieder individu reageert anders op geneesmiddelen, voeding en omgevingsstoffen, net zoals op micro-organismen.
In onze 3 miljard DNA-nucleotides zitten een 22.000 genen, die tot honderdduizenden eiwitproducten kunnen leiden.
In ieder van onze 100 biljoen cellen is de onderlinge verhouding van deze eiwitten ook weer anders; geen enkele cel is gelijk; net als individuen nooit gelijk zijn ( zelfs eeneiige tweelingen niet ) .
Veranderingen op DNA-niveau kunnen leiden tot veranderingen op RNA- en eiwitniveau.
Denk hierbij niet alleen aan punt-mutaties, maar ook aan volledige deleties, alternatieve manieren om de exonen in het mRNA te koppelen bij het weghalen( uitsnijden ) van de intronen, frame shifts, repeats en andere complexe zaken.
Alles wat fout kan gaan, is fout gegaan.
Het enige dat echt bewaard is gebleven is de TTAGGG sequentie die aan de staart van de chromosomen (telomeren) zit.
TTAGGG is een menselijke telomeer-sequentie van een basis -sequentie die bij alle (aardse )levende wezens aanwezig is (zie tabel onder ) :

Telomeer <

Een telomeer bestaat uit enkelstrengs DNA en zit aan het uiteinde van een chromosoom. Telomeer betekent in het Grieks eindstuk. Een telomeer komt niet voor bij prokaryoten met een ringvormig chromosoom.

Oude cellen hebben chromosomen met een korter telomeer dan jonge cellen. Een uitzondering hierop werd echter in 2003 ontdekt bij het Vaal stormvogeltje, waarbij de telomeren bij het ouder worden van de vogel juist in lengte toenemen.

Een telomeer is te vergelijken met het plastic uiteinde van een veter. Bij iedere deling rafelt het uiteinde een stukje uit en uiteindelijk kan de cel niet meer delen en sterft. Menselijke cellen bereiken dit stadium na zo’n vijftig, zestig delingen.

Als de telomeerlengte behouden blijft, kan de cel zich blijven delen zonder dood te gaan. Onder de microscoop is een telomeer zichtbaar als een oplichtend puntje.

T-loop

Een telomeer bestaat uit repeterende stukjes DNA dat de belangrijke genen beschermt tegen het korter worden van de chromosomen. Ook is het telomeer belangrijk voor de stabiliteit van het chromosoom. Bij de mens bestaat het repeterende stukje DNA uit de sequentie TTAGGG en is het telomeer tussen de 3 en 20 kilobasen lang. Tussen het telomeer en de rest van het chromosoom zit nog een stukje dat 100 tot 300 kilobasen lang is. Hierdoor kan het telomeer een soort lasso, T-loop, vormen. De sequentie verschilt per organisme, maar bevat gewoonlijk veel GC (Guanine en Cytosine) nucleotiden.

Telomerase

Tijdens de celdeling wordt het DNA via replicatie verdubbeld. Het enzym DNA-polymerase kan echter het eind van het chromosoom niet repliceren, omdat het voortijdig van het DNA afvalt. Hierdoor worden bij elke celdeling de chromosomen korter. Het enzym telomerase dat een reverse-transcriptase is, kan een telomeer weer langer maken en komt voor in de kiembaancellen die de geslachtscellen maken, stamcellen, kankercellen en protozoa. Telomerase bestaat uit een enzymatisch deel en een RNA deel, de complementaire sequentie.

Verantwoordelijk gen

Het gen dat verantwoordelijk is voor de vorming van telomerase is in 1998 door Geron Corporation in Californië gekloond en ingebracht in cellen. Deze cellen hebben zich twee jaar lang gedeeld zonder enige vorm van veroudering. Ze lijken onsterfelijk te zijn geworden.

DNA-herstelmechanisme

Elke cel beschikt over een DNA-herstelmechanisme dat beschadigd DNA repareert. Als het DNA te veel beschadigd is en niet meer hersteld kan worden, stopt de cel met delen of gaat dood. Als het telomeer 4 kilobasen kort is geworden kan het geen lus meer maken en ziet het DNA-herstelmechanisme het eind van het chromosoom als een gebroken chromosoom waardoor de cel stopt met delen of dood gaat.

Klonen

Bij klonen van cellen vertrekt men van cellen die al kortere telomeren hebben. Het nieuw organisme vertrekt dus met kortere telomeren.

Enkele bekende telomeren sequenties
Groep Organisme Telomeer repeterend stukje DNA (repeat) (5′ → 3′ richting eind)
Gewervelden Mens, muis, Xenopus TTAGGG
Draadvormende schimmels Neurospora crassa TTAGGG
Slijmzwammen Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastiden protozoa Trypanosoma, Crithidia TTAGGG
Ciliophora (protozoa) Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexan (protozoa) Plasmodium TTAGGG(T/C)
Hogere planten Arabidopsis thaliana TTTAGGG
Groene algen Chlamydomonas TTTTAGGG
Insecten Bombyx mori TTAGG
Rondwormen Ascaris lumbricoides TTAGGC
Celdelende gisten Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Knopvormende gisten Saccharomyces cerevisiaeCandida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis
TGTGGGTGTGGTG (van RNA ‘mal’ (template))of G(2-3)(TG)(1-6)T (consensus)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT
Over de evolutie van de genetische code
op januari 2, 2012

Eerst gaat het vaak over de abiogenesis, ofwel het ontstaan van de eerste macromoleculen (DNA, RNA en eiwitten) uit de beschikbare moleculen in de ‘primordiale soep’. Daarbij springt vooral het werk van Ernesto Di Mauro (1, 2) in het oog, die liet zien dat zich in water zonder katalyserende enzymen spontaan lange ketens van nucleotiden (ofwel basen) kunnen vormen. In zijn experimenten ging het om heel eenvoudige ketens van maar één van de vier basen.

Genetische code

De genetische code: A, G, C en U zijn de vier basen van het RNA die de drieletterig code vormen voor de aminozuren (aangegeven met kleine letters)

Nucleotiden ofwel basen zijn de letters van het DNA en het RNA. DNA kent iedereen als de moleculen waarin onze genen opgeslagen liggen. De genen worden gelezen en zo wordt er in de celkern mRNA van gemaakt dat een bijna exacte kopie is van het DNA. Het DNA en het RNA bestaan uit vier verschillende letters (A, G, C en T of U). Bij de productie van eiwitten, wordt het mRNA afgelezen waarbij de letters in groepjes van drie worden herkend door het transferRNA ofwel het tRNA. Die groepjes van drie zijn de codons. Deze zijn complementair aan een tRNA dat een specifiek aminozuur draagt. Aangezien we vier ‘letters’ hebben die zich in groepjes van drie kunnen combineren, bestaan er 4^3 = 64 verschillende codons. De eiwitten, die uit ketens van aminozuren bestaan, zijn uit slechts 20 verschillende aminozuren opgebouwd. In de tabel zijn de codons met hun corresponderende aminozuren te zien; dit is de genetische code. Het blijkt dat de code voor elk aminozuur voornamelijk bepaald wordt door de eerste twee letters. De derde is vaak irrelevant. Deze derde positie wordt ook wel de Wobble positie genoemd en de code zelf is zogezegd gedegenereerd. Het gangbare idee is dat de oorspronkelijke primordiale code slechts uit twee nucleotiden bestond en dat daar vervolgens een code van drie basen uit ontstaan is.

Translatie

Fig. 1 Translatie: Het tRNA hecht zich met het anti-codon aan het codon van het mRNA (groen). Het gedragen aminozuur wordt vastgehecht aan de groeiende peptide.

Een belangrijke rol heeft het tRNA. Dit tRNA heeft een arm waarvan het uiteinde van de lus complementair is aan het codon van het mRNA. Het tRNA, dat een specifiek aminozuur draagt, hecht zich met zijn anti-codon aan het mRNA zodra ‘zijn’ codon aan de beurt is om vertaald te worden (zie fig. 1). Het aminozuur hecht zich aan de keten aminozuren en is daarmee deel van het groeiende eiwit. De code is gedegenereerd wat betekent dat er verschillende tRNA’s zijn die hetzelfde aminozuur dragen.

De allerbelangrijkste speler is wel de synthase van het tRNA. Dit enzym is verantwoordelijk voor de juiste koppeling van een tRNA aan het bijbehorende aminozuur (zie fig.2) . Het is de ware tweetalige protagonist die de brug legt tussen de vier lettercode van het DNA/RNA en de twintig lettercode van de eiwitten. Hier is een filmpje te zien van hoe dat in zijn werk gaat. Een kant van het enzym leest het anti-codon en de andere kant hecht het juiste aminozuur aan het andere uiteinde van het tRNA. Elk aminozuur heeft zijn eigen tRNA-synthase.

tRNA synthase

Fig. 2. tRNA synthase (geel), tRNA (rood)

Er bestaan twee groepen tRNA-synthase. Elke groep bestaat uit 10 enzymen. De twee groepen verschillen van elkaar voor wat betreft hun actieve site, hun sequentie, en de plek waar het aminozuur vastgemaakt wordt. Op dezelfde manier kunnen de aminozuren in twee groepen verdeeld worden. Dit heeft geleid tot het idee dat de twee groepen apart van elkaar geëvolueerd zijn of zelfs na elkaar. Het zou kunnen dat er ooit twee codes naast elkaar bestonden en dat deze twee zich samengevoegd hebben. Het zou ook kunnen dat er in eerste instantie heel eenvoudige eiwitten bestaan hebben van slechts 10 aminozuren (groep II) in plaats van 20. Studies van sterk geconserveerde sequenties, die dus erg oud zijn, tonen aan dat deze voornamelijk uit groep II-aminozuren zijn opgebouwd. Deze primordiale verdubbeling van de genetische code laat zien dat de code niet eenvoudigweg een ‘bevroren toeval’ is zoals Crick beweerde, maar wel degelijk een optimale code is. Uit: Apoorva Patel (2004);Woese et al. (2000);José et al. (2009)

WOBBLE POSITIE : De derde codonpositie is vaak niet relevant. waarom er dan nog 64 codons moeten bestaan ? Veel overlap ?Redundantie ? “vaak ” in de bovenstaande zin , moet genuanceerder zijn : ….immers : ‘De 3de base(letter) ___De”wobble” positie ___ is wél relevant bij aminozuren die maar door 1,2 of 3 codons worden gecodeerd en is niet relevant bij aminozuren die door 4 codons worden, gecodeerd.’ –*De 64 codons zijn simpelweg het gevolg van het feit dat een codon uit 3 basen bestaat. Daar volgen dus 4^3 = 64 (mogelijke combinaties ) codons uit. Deze zogenoemde “degenererende “eigenschap ( met als resultaat een mogelijke “overbodige (=redundante )” overlap “) manifesteert zich op niveau van de aminozuren waarvan er slechts 20 zijn voor 64 codons. -In zekere zin is het toch wat speciaal dat er tegenwoordig 64 codons in omloop zijn ....want er wordt serieus gespeculeerd over het feit dat de (oudste) code ooit uit twee basen bestond i.p.v. drie. Je spreekt in die optie dan alleen niet van “degenereren ” omdat de code van twee naar drie basen zou gegaan zijn. Enig idee waarom die code van 2 naar 3 ging terwijl er een hoop wobbles zijn?
-Het waarom is lastig. Als je zoals Apoorva Patel ervan uitgaat dat er aan het begin van het leven twee codes bestonden met codons van twee basen dan levert dat 2 x 4^2= 2 x 16 aminozuren. Meer dan genoeg voor de twintig die we kennen. Dus een codon van twee nucleotiden omdat het ‘simpeler’ was?
De derde nucleotide of base had absoluut geen rol. Maar hij zat er dus wel. Dit alles is gebaseerd op het feit dat de tRNA’s van twee klassen zijn. Elke klasse draagt 10 verschillende aminozuren.
Het anticodon van tRNA heeft drie nucleotiden/basen
. Er wordt wel beweerd dat de kromming in de ‘loop’ van het anticodon ervoor zorgt dat de derde base niet hoeft te matchen.

NOTES  G 

NoteDE GENETISCHE CODE 

In DNA vormen de nucleotide basen een eenvoudig vierletter alfabet dat kan coderen voor de 20 aminozuren die voorkomen in eiwitten.
De taal van de genetische code ligt bevat in codonen, woorden voor individuele aminozuren.
Elk codon is exact drie basen lang.
Een gen kan voorgesteld worden als een zin die volledig is samengesteld met deze drie letterwoorden. Op het eerste zicht kan dit alfabet te beperkt lijken.
Maar als de vier letters in combinaties van drie worden gebruikt, zijn er 64 verschillende combinaties mogelijk.
Inderdaad, vele aminozuren kunnen beschreven worden met meer dan één codon.
Het basismechanisme van de genetische code is vergelijkbaar bij vele organismen.Omwille van deze gelijkenis, is het soms mogelijk om een DNA segment van één bron te nemen en hetzelfde gedrag bij een andere te voorspellen.
Een DNA segment kan bijvoorbeeld ingebracht worden in een gastheerorganisme, zoals een bacterie, waardoor de bacteriën het menselijk eiwit zullen produceren.
Dit is de sleutel voor genetic engineering.http://nl.wikipedia.org/wiki/Genetische_codeet een vier-letter code kunnen 64 verschillende combinaties van elk drie letters worden gemaakt, die de bouwstenen voor de eiwitten coderen –
de aminozuren.
Omdat er maar 20 verschillende aminozuren in eiwitten voorkomen en er 64 combinaties mogelijk zijn, zijn er 44 combinaties over.
Drie daarvan worden gebruikt als stopsignalen (1a) die de moleculaire machientjes vertellen wanneer het eiwit klaar is, maar welke functies zouden de
resterende 41 combinaties kunnen vervullen?
Het blijkt dat ze ook gewoon coderen voor één van de 20 aminozuren.
Sommige aminozuren worden namelijk door verschillende combinaties gecodeerd.(1b)De aminozuren serine, arginine en leucine worden bijvoorbeeld op zes verschillende manieren gecodeerd.
Vijf andere aminozuren – alanine, glycine, proline, threonine en valine – worden door vier codes gespecificeerd.
De overige aminozuren worden door één, twee of drie codes gespecificeerd.
Vijf komt niet voor.OPMERKINGEN :
Bron : blog van een creationist =
http://www.vkblog.nl/bericht/268733/Nogmaals_voor_dovemansoren
( Lees vooral het commentaar van Peter Mudde )

Volgens intelligent Design aanhangers is deze hierboven (kort) beschreven code de ” slimste ” oplossing …

Maar er zijn wel degelijk slimmere oplossingen te bedenken.
Je kunt een mutatiebestendige code bedenken, een extra controlesysteem …(2)

Een code b.v. die bestaat uit een drie maal herhaald triplet..
Je hebt dan negen baseparen per aminozuur nodig, maar als je vervolgens in je systeem inbouwt dat als er van de drie tripletten er 1 afwijkt,
die weer hetzelfde gemaakt wordt als de twee andere tripletten, ben je bijna foutbestendig.
Je kunt ook eiwitten opbouwen uit minder dan 20 aminozuren zonder dat ze noemenswaard in werking achteruit gaan

De bewering
“Omdat er maar 20 verschillende aminozuren in eiwitten voorkomen .. tot… Elke andere andere verdeling is slechter.”
is weinig steekhoudend.
Het klinkt mooi, maar waarom zou elke andere verdeling slechter zijn?

Het is ook maar hoe je het brengt..
Sommige aminozuren worden gecodeerd niet door drie, maar door slechts de eerste twee basenparen van een triplet..
Het derde paar hangt er voor spek en bonen bij..

-De derde positie ( =het derde basenpaar ) __door Peter Mudde terecht “Het derde paar hangt er ( soms ) voor spek en bonen bij..”, genoemd ___
is het zogenaamde “wobble” paar … toch ?
(Las ik bij de leuvense geneticus prof . Cassiman )

NOTEN
(1)
a) naast de “stop-codons ” is er slechts één “start ” codon ( AUG-codon )
–> zie http://nl.wikipedia.org/wiki/Methionine

b) Het feit dat verschillende codons coderen voor dezelfde basisbouwstoffen ( pakweg 20 aminozuren )
“degenerancy” van de genetische code genoemd …
Zie hier een aanklikbare link die over dit onderwerp gaat
arxiv.org/ftp/math/papers/0607…

(2)
alleen heb je dan geen bron van mutaties meer die het genetische “ontwerp” van een bestaand organisme in zijn afstammingslijnen laat “adapteren”aan
het veranderend millieu en het daardoor vroeg of laat tot uitsterven doemt ..
= Het is dan ook niet nodig (of erg slim ) dat zulke systemen zich(altijd) vermenigvuldigen als ze dan toch gedoemd zijn tot uitsterven …

Over tsjok45
Gepensioneerd . Improviserend jazzmuzikant . Instant composer. Jamsession fanaat Gentenaar in hart en nieren

One Response to Genetische code

  1. Pingback: VERKLARENDE WOORDENLIJST PALEONTOLOGIE E | Tsjok's blog

Geef een reactie

Vul je gegevens in of klik op een icoon om in te loggen.

WordPress.com logo

Je reageert onder je WordPress.com account. Log uit / Bijwerken )

Twitter-afbeelding

Je reageert onder je Twitter account. Log uit / Bijwerken )

Facebook foto

Je reageert onder je Facebook account. Log uit / Bijwerken )

Google+ photo

Je reageert onder je Google+ account. Log uit / Bijwerken )

Verbinden met %s

%d bloggers op de volgende wijze: