FOSSIELEN


°
   
 TAFONOMIE  —>  tafonomie   Doc archief

550-million-year-old fossils provide new clues about fossil formation

December 18, 2014
University of Missouri-Columbia
Summary:
A new study is challenging accepted ideas about how ancient soft-bodied organisms become part of the fossil record. Findings suggest that bacteria involved in the decay of those organisms play an active role in how fossils are formed — often in a matter of just a few tens to hundreds of years. Understanding the relationship between decay and fossilization will inform future study and help researchers interpret fossils in a new way.
Conotubus. Three-dimensionally pyritized tube-worm like fossils, Conotubus, from the 550 million year old Gaojiashan Lagerstätte, Shaanxi Province, South China.
Credit: Yaoping Cai, Northwest University, Xi’an, China.
  1. James D. Schiffbauer, Shuhai Xiao, Yaoping Cai, Adam F. Wallace, Hong Hua, Jerry Hunter, Huifang Xu, Yongbo Peng, Alan J. Kaufman. A unifying model for Neoproterozoic–Palaeozoic exceptional fossil preservation through pyritization and carbonaceous compression. Nature Communications, 2014; 5: 5754 DOI: 10.1038/ncomms6754
  2. http://munews.missouri.edu/news-releases/2014/1217-550-million-year-old-fossils-provide-new-clues-about-fossil-formation/

Conotubus Fossil

Download larger image

Three-dimensionally pyritized tube-worm like fossils, Conotubus, from the 550 million year old Gaojiashan Lagerstätte, Shaanxi Province, South China. Photo credit: Yaoping Cai, Northwest University, Xi’an, China.

Hoe snel verdwijnt een lichaam in de oceaan?

 

 

 

 

 

 

 

 

 

 

 

 Enkele kilometers voor de kust gooit men  een  stoffelijk overschot overboord. Hoe lang duurt het voordat het lichaam verdwenen is?

Canadese wetenschappers hebben het antwoord gevonden.

Onderzoekers van de Simon Fraser universiteit gooiden drie dode varkens in een inham van de Grote Oceaan, net voor de Canadese kust. Er zijn geen mensen gebruikt, omdat dat ethisch niet erg verantwoord is. Toch lijken varkens en mensen op elkaar als het gaat om de snelheid van ontbinden.

Zuurstofniveau
Wat blijkt: de snelheid waarmee een lichaam verdwijnt is afhankelijk van het zuurstofniveau in het water. Wanneer het zuurstofniveau hoog is, bevinden er veel aaseters in het water, zoals krabben, kreeften en garnalen. Twee van de drie varkens werden al snel ontdekt door de kleine aaseters, waardoor er na 25 dagen niet veel meer over was dan de botten.

Een derde varken eindigde in water met een laag zuurstofniveau. Hierdoor bleef het karkas redelijk onaangetast. Wel vormde er een dikke, bacteriële laag op het lichaam. In de lente steeg het zuurstofniveau, waardoor de aaseters terugkwamen om het derde varken te verorberen. Zelfs 135 dagen na de tewaterlating was het derde varken nog niet volledig vergaan.

Foto’s
Benieuwd naar de foto’s? Dat begrijpen we heel goed. Hieronder kun je de snelheid van het ontbinden zien. De eerste twee fotoreeksen tonen de twee varkens die snel ontbinden, de derde fotoreeks laat het varken zien dat een tijdje bedekt is door een bacteriële laag. Een waarschuwing: heb je net gegeten, scroll dan niet verder!

Varken 1 (zuurstofrijk water)

karkas-1 (2)

Varken 2

 

 

(zuurstofrijk water)

  • karkas-2 (1)

 

 

Varken 3 (zuurstofarm water)

karkas-3 (1)

—>

Bronmateriaal:

Deep Coastal Marine Taphonomy: Investigation into Carcass Decomposition in the Saanich Inlet, British Columbia Using a Baited Camera” – PLOS ONE

 

—> ÖTZI

 

Creationisten en tafonomie

Fossiele walvissen in Peru: zondvloed of niet?

  op okt.31, 2014,

PiscoOver  :  De vondst van ‘puntgave’ begraven walvissen in een 400 meter dikke aardlaag in het zuiden van Peru (de Pisco formatie).

Het artikel waarin dit beschreven staat is gepubliceerd in een keurig wetenschappelijk tijdschrift, en het beschrijft een veertigtal fossielen waarbij de baleinen nog aan de kaak vastzitten.

Dat is bijzonder, aldus de auteurs, want baleinen zitten in het tandvlees vast en vallen dus snel uit de bek tijdens de ontbinding van een karkas.

De conclusie is dat de dieren binnen enkele uren tot enkele dagen na hun dood moeten zijn begraven.

De creationistische interpretatie hiervan is dat

de dieren door de zondvloed moeten zijn bedekt. (1)

Hier is het een en ander op af te dingen.

  • —> Allereerst: de reguliere geologie sluit op geen enkele manier catastrofale gebeurtenissen uit.
  • In hun boekThe Bible, Rocks and Time’  laten Young & Stearly zien dat er tal van massagraven aanwezig zijn in het fossielen archief.
  • Echter, in die massagraven vind je precies de fossielen die je verwacht binnen één ecosysteem. Dus geen gevolgen van een enorme vloed, maar van een lokaal proces.
  • Doorgaans vind je onder en boven de massagraven ook fossielen, dus er zijn op verschillende tijden dieren dood gegaan.

Iets dergelijks vind je ook in de Pisco formatie.

 

Een ander artikel dat deze formatie beschrijftspreekt van zeker vier massastrandingen van voornamelijk zeezoogdieren.

Het beschrijft de plek waar de fossielen liggen als een baai met een modderplaat die boven de vloedlijn lag.

Daar zijn door stormen drijvende karkassen tot boven de vloedlijn neergesmeten.

De omgeving daar was woestijnachtig droog en rijk aan ijzer.

De droogte werkte preserverend, net als het ijzer.

In de droge woestijn bevonden zich geen grote roofdieren, en haaien konden niet bij de karkassen.

De meest waarschijnlijke doodsoorzaak was een opwelling van water met giftige algen, die door het ijzer dat van de berg afwaait zich sterk vermenigvuldigden (een ‘algenbloei’).

De dieren waren dus al dood toen ze op het land terechtkwamen. Er zijn ook een paar dode luiaards gevonden, die mogelijk in contact zijn gekomen met het giftige water.

Zondvloed

Eén opmerking is interessant:

Tusnamis would have generated death assemblages lacking large body size selectivity and would result in high-energy sedimentary structures that are not present.’

Dus: er zijn geen sporen van een vloedgolf die je zou verwachten bij de zondvloed.

De verklaring van de fossielen in de Pisco formatie is geen groot probleem voor de reguliere modellen (die er ook vanuit gaan dat de afzetting als geheel in tienduizenden jaren is gevormd), maar toont geen enkel spoor van een wereldwijde zondvloed. De karkassen zijn boven de vloedlijn terechtgekomen na een storm, en bedekt met zand in een omgeving die zorgde voor trage ontbinding en mogelijk zeer snelle bedekking met zand.

Om Young & Stearly nog eens te herhalen: het feit dat er catastrofes hebben plaatsgevonden betekent niet dat er een zondvloed is geweest.

De Pisco formatie bewijst op geen enkele manier dat de reguliere geologische interpretatie onjuist is, en toont geen enkel spoor van een wereldwijde zondvloed.

En nee, ik heb zo snel geen verklaring gevonden voor het feit dat de baleinen bij deze 40 walvissen (en zeer zeker niet bij álle walvissen die hier gevonden zijn, zie de afbeelding!) nog in situ lagen, maar door op dit ene detail in te zoomen verhult de creationistische interpretatie het feit dat er in deze afzetting geen sporen van een wereldwijde zondvloed zijn te vinden.

°

zie ook

ATACAMA walvis massagraf | Tsjok’s blog  <—

tsjok45.wordpress.com/2014/02/26/atacama-walvis-massagraf/
 26 feb. 2014 – Mysterie van fossiel massagraf opgehelderdatacama discovery … “Tegenwoordig promoot opgelost ijzer de bloei van schadelijke algen en de Andes ….Filed under anticreato, Dierkunde, evodisku A, fossielen, GEOLOGIE,  

(1)

 komt van crea-wiki,     http://creationwiki.org/Pisco_formation    Dat is nml   de creationistische context die ik vind rond deze uitspraak :

‘The Pisco formation is an amazing site. The rapid burial of the whales and preservation of their baleen depict a story of whales perishing in a diatom bloom in the late flood period.’

MAAR ;

  • ik krijg het idee dat Pyenson een andere Cerro Ballena in Chili (droge fixatie, geen diatomeeën) beschrijft, en niet Brands Peruviaanse Pisco Cerro Ballena (fixatie door diatomeeënsilicaschaaltjes     depositiesnelheid van 3 tot 4 grootte-ordes hoger dan gebruikelijk).
  • (Pyenson )                                                                                                                                                                      http://nmnh.typepad.com/pyenson_lab/cerro-ballena
  • /La_Familia_Texture_med_crop2     An image from a 3D model of three fossil whales from Cerro Ballena, colloquially called “La Familia.” This image is also part of Figure 4 in our paper, out today.            http://cerroballena.si.edu
  • ( Brand  e.a. )                                                                                                                        http://www.sciencedirect.com/science/article/pii/S0031018207005718

–>Verwarrend,

ik vond die tweede publicatie omdat die verwees naar een stuk van Brand. En allebei Cerro Ballena… Maar Chili versus Peru ……. had mij moeten opvallen

 Het argument blijft grotendeels overeind, al kan ik nu niet zeggen dat er op de site in Peru van Esperante & Brand geen sporen van een tsunammi zijn. —> Dat geldt alleen voor de site in Chili.
°

Wat zou dan het probleem kunnen zijn van “in-situ” gevonden nauwelijks verteerde walvissen  ?

antwoord van  Geoloog Leon :

(   hier om de hoek  te  vinden  in diatomiet-afzettingen:)

complete padden, met huid en haar
http://www.musee-fossiles.com/uploads/images/site%20diatomite/crapaud%202.jpg

ratten
http://www.musee-fossiles.com/uploads/images/Fossiles%20des%20diatomites%20du%20Coiron/Parapodemus-sp..jpg

vogels
http://www.paleodecouvertes.org/wp-content/uploads/2012/10/Ancetre-pigeon.jpg

 

Diatomiten produceren soms giftige stoffen waarin die beesten stikken, ze “bloomen” en begraven dus soms heel snel, ter plaatse. Ze komen voor in zout én zoet water.

°

Virtual Geology Museum

sponsored by  Cochise College  
 Hall of Fossils  

brachiopod douglascamp29

Mucrospirifer prolificus-1
Silica Formation-Devonian
Medusa Portland Cement quarry, Silica, Ohio

width: 5.1 cm




Attractions:
 fossils-special exhibits 
invertebrate fossil links
photos of fossils (below)

index of fossil photos

number of photos: 1305      last edited:  12/10/09  
Dinosaurs are listed under reptiles.  

 

Ammonite  ;  parapuzosia_seppenradensis

Parapuzosia_seppenradensis_4

ammonites  (50) frogs  (1) reptiles  (156)
archaeocyathid  (1) fusulinids  (3) scorpions  (2)
barnacles  (11) gastroliths  (1) sea bottom fossils  (11)
birds  (19) gastropods  (74) sea cucumbers  (3)
blastoids  (11) graptolites  (1) sea urchins  (29)
brachiopods  (84) insects  (28) shrimp (3)
bryozoa  (18) jellyfish  (5) sponges  (4)
carpoids  (10) limpet  (2) starfish  (17)
cephalopods-straight  (25) lobsters  (4) stromatolites  (16)
coprolites  (3) mammals  (123) trilobites  (126)
corals  (88) pelecypods  (53) unsorted fossils  (1)
crabs  (4) plants-ferns  (37) worms  (8)
crinoids  (83) plants-trees  (76)
eurypterids  (15) plants-leaves  (32)
fish  (64) amphibians  (7)


 Roger Weller, curator ( wellerr@cochise.edu )

°
Fossielen
Fossielen  dino 
Ieder mens die met open blik in de natuur om zich heen kijkt, zal zich op bepaalde ogenblikken verwonderen over de verscheidenheid aan vormen in de dieren- en plantenwereld die hij of zij daar ziet.
Niet iedereen zal echter beseffen dat we om ons heen of via de natuurfilms op de televisie slechts een zwakke afspiegeling zien van alle dieren- en plantensoorten die ooit onze aarde bevolkten.Veel meer dieren- en plantensoorten zijn inmiddels van de aardbodem verdwenen, dan er op dit ogenblik rondlopen en groeien. .
We willen terug gaan in de   tijd , geen tientallen jaren, zelfs geen tientallen miljoenen jaren, maar honderd miljoen jaren en meer om naar de toen levende planten en dieren te kijken.
Helaas was toen de fotografie of televisie nog niet uitgevonden en er liepen ook geen mensen rond op de aarde, zodat we geen beelden hebben, noch mondelinge overleveringen van het uiterlijk van deze planten en dieren.
Ons een beeld voor ogen toveren van het uiterlijk van dit in de tijd zo ver verwijderd leven lijkt daarom een onmogelijke opgave.
We zeggen met opzet “lijkt”, want gelukkig is er uit deze heel ver achter ons liggende tijd het één en ander overgebleven.
Deze overblijfselen, die ons de mogelijkheid geven iets van dat oude leven te reconstrueren, noemen we fossielen.
Onvoorstelbaar, dat zaken van honderden miljoenen jaren geleden op de dag van vandaag er nog zijn! Als het bosje bloemen dat vandaag gekocht wordt, over een week verlept is en op de composthoop gegooid wordt en na een paar maanden niet meer als zodanig herkenbaar is, dan mogen zaken die na een paar honderd miljoen jaar nog herkenbaar zijn toch wel een  wonder genoemd worden.

Maar wat zijn nu eigenlijk fossielen?

Herkenbaarheid
Het woord fossiel komt van het Latijnse fossilis, met de betekenis van “hetgeen op- of uitgegraven is”. Tot de 18e eeuw werden onder het begrip fossiel dan ook allerlei natuurlijke zaken die in de grond gevonden werden verstaan, ook mineralen en vreemd gevormde stenen. In latere eeuwen werd het begrip uitsluitend gebruikt in samenhang met overblijfselen van vroeger levende wezens. Onder fossielen verstaat men tegenwoordig in het algemeen elk herkenbaar spoor of elke herkenbare aanwijzing van vroeger organisch leven. Deze aanwijzingen kunnen de gefossiliseerde harde delen betreffen, zoals beenderen, schelpen of tanden, maar ook afdrukken, loop- en kruipsporen, graafgangen, vraatsporen, uitwerpselen, etc. De wetenschap die de fossielen bestudeert, noemt men paleontologie. Deze wetenschap kan weer opgesplitst worden in een drietal deelgebieden: paleozoölogie, de studie van fossiele dieren, paleobotanie, de studie van fossiele planten, en paleoantropologie, de studie van fossiele mensachtigen. 
°
Paleontologie
Paleontologen proberen door reconstructies aan de hand van de gevonden fossielen een beeld te scheppen van het uitgestorven organisme en van de manier waarop het functioneerde bij de omstandigheden die er in dat verre verleden heersten. Samenwerking met aardwetenschappers uit andere disciplines is daarbij noodzakelijk. Door veel van dit soort studies te combineren is het mogelijk een min of meer gedetailleerd beeld te krijgen van het leven op aarde in deze lang vervlogen tijden.
°
Onvervangbare zeldzaamheid
Fossielen
Crinoiden kalk 

Het proces dat fossielen doet ontstaan noemen we fossilisatie. In principe kunnen alle delen van een organisme fossiliseren, maar het zal duidelijk zijn dat harde delen de meeste kans op fossilisatie maken. Overblijfselen van dode organismen worden gewoonlijk snel opgeruimd door bacteriën (verrotting), chemische afbraak of aasvreters. Voor fossilisatie is het dus noodzakelijk dat het dode organisme, liefst zo snel mogelijk, van de buitenwereld wordt afgesloten. Dit afsluiten gebeurde meestal door bedekking van het dode dier of de dode plant met sediment (zand, klei of kalkslib).
Als we nagaan hoeveel factoren het fossiliseren van een dood organisme kunnen verhinderen, moeten we wel tot de conclusie komen dat elk fossiel in feite een hoogst zeldzame verschijning is. Slechts een zeer klein percentage van alle organismen die ooit op aarde hebben geleefd is door fossilisatie bewaard gebleven en aan ons overgeleverd. Zelfs de “gewone” fossielen hebben er daarom recht op zorgvuldig door ons behandeld te worden.
°
Duurzaam materiaal
De meest eenvoudige fossilisatie is het bewaard blijven van harde delen (tanden, schelpen, e.d.) van het oorspronkelijke organisme. Een andere vorm van fossilisatie is de vervanging van het oorspronkelijke materiaal van het organisme door ander, duurzamer materiaal. Het resultaat van dit proces ziet men bijvoorbeeld bij versteend hout. Hierbij is de oorspronkelijke cellulose van de plantencellen deeltje voor deeltje vervangen door een mineraal, vaak kwarts of een variëteit ervan.
Het komt ook voor dat holtes in de harde delen worden opgevuld door sediment of door mineralen die uitkristalliseren uit het circulerende grondwater. Als hierna de oorspronkelijke bestanddelen worden afgebroken, blijft een afdruk van de binnenzijde van het oorspronkelijke onderdeel over.Indien het oplossen van de oorspronkelijke delen gebeurt vóór de opvulling met sediment of het uitkristalliseren van mineralen, is het uiteindelijke resultaat een afdruk van de buitenkant van het oorspronkelijke onderdeel. Uiteraard resulteren de hier beschreven processen ook in een negatieve afdruk van de buitenkant van de oorspronkelijke delen in het omringende gesteente, op zich ook weer een fossiel.
Een speciale vorm van fossilisatie is het inkolingsproces, waarbij met name plantaardige organismen bewaard blijven als zeer dunne laagjes koolstof. De vroeger voor verwarming en voor opwekking van elektriciteit belangrijke steenkool is hiervan het resultaat. Ook graaf-, loop- en kruipsporen kunnen door opvulling met een sediment dat afwijkend is van de ondergrond bewaard blijven en worden eveneens als fossielen beschouwd. Evenals uitwerpselen, coprolieten genaamd, welke dezelfde fossilisatieprocessen kunnen ondergaan als delen van het oorspronkelijke organisme.
°
Weke delen: superzeldzaam
dickensonia 2
Dickensonia 
In zeer zeldzame gevallen kunnen ook afdrukken van weke delen van een organisme bewaard blijven. Dit geschiedt uitsluitend als door bijzondere omstandigheden het verrottingsproces geen kans krijgt om zijn vernietigend werk te doen. Zo zijn er afdrukken bekend van de huid van dinosaurussen, van de vlieghuid van vliegende reptielen en zelfs van zulke tere dieren als kwallen. Een aantal vindplaatsen is specifiek bekend omdat daar weke delen op relatief grote schaal bewaard zijn gebleven, zoals de Ediacara-fauna in Australië en, dichter bij huis, Bundenbach in Duitsland.
Een ander bijzonder geval van fossilisatie is het bewaard blijven van het oorspronkelijke organisme door insluiting in barnsteen. Het meest bekend zijn natuurlijk de insecten in barnsteen. Heel bijzonder zijn enkele vondsten van kleine ingesloten hagedissen. Barnsteen is niets anders dan fossiele hars van een naaldboom. In deze kleverige hars bleven vele insecten vast zitten, deze werden in de loop van de tijd geheel met hars bedekt. De dieren werden zo perfect bewaard en de fijnste details (voelsprieten, poten, monddelen, e.d.) zijn vaak nog goed te bestuderen.
°
Barnsteen uit de Dominicaanse Republiek,
met een mug ingesloten(coll. Naturalis )
°
Grote dieren
Nog spectaculairder zijn natuurlijk de mammoeten, die met huid en haar, en zelfs met de maaginhoud, geconserveerd werden in de als een reusachtige vriescel werkende, permanent bevroren bodem van de toendra’s in Siberië.kies van mammoetjong, 6 x 12 cm; Pleistoceen; –>
Fossielen
Doggersbank
°
In Wyoming in de Verenigde Staten heeft men zelfs gemummificeerde dinosaurussen uit het Krijt gevonden, die na hun dood ca 130 miljoen jaar geleden zeer snel uitgedroogd moeten zijn, zodat geen verrotting optrad.
Goed zoeken – soms vinden.
°
 ENKELE   FOSSIELEN    
Ammoniet Schlotheimia angulata,
-Jura; 
Ichnofossielen
Ichnofossielen zijn fossiele sporen van levensvormen. Pootafdrukken, graafgangen, kruipsporen worden hiertoe gerekend. Soms worden wel de sporen van een organisme teruggevonden, maar het is dan onbekend welk organisme ze heeft achtergelaten.

Negatief en positief fossiel met voetstappen van Procolophonichnium sp. Procolophonid parareptile vindplaats winterswijk 2014. Trias.

undefined

undefined

°

Rhynchosauroides peabodyi (Faber)
http://natuurtijdschriften.nl/download?type=document&docid=405920

http://www.fossiel.net/id_system/fossil_id_search.php?zoek=Rhynchosauroides%20peabodyi&soortenlijsttijdperk=1006&soortenlijstepoch=1027&soortenlijstetage=1096&soortenlijstformatie=

Afdruk achterpoot.

LocatieGevonden in: Winterswijk, Nederland >>ZieSoortenlijst
Datum: september 2005
Stratigrafie
Periode: Trias >> Epoch: Midden Trias   >> Etage: Anisiaan >> Soortenlijst

 

foto’s van Sporenfossielen  <—

Noch de evolutietheorie noch de geschiedenis van het leven op deze planeet wordt uitlsuitend gedocumenteerd aan de hand van ” gereconstrueerde ” fossielen
Reconstructie evolutie
In de fylogenetische systematiek proberen we de verwantschappen tussen de soorten en de veranderingen van de kenmerken in de loop van de evolutie te achterhalen. Kortom: we proberen de evolutie te reconstrueren.
Soortvorming en kenmerkverandering

Bij soortvorming moet tenminste 챕챕n van beide nieuw gevormde soorten er anders gaan uitzien dan de oudersoort. Anders zouden de nieuwe soorten denken dat ze nog steeds 챕챕n soort waren. Een nieuwe soort, laten we hem A noemen, is dus een mengelmoes van kenmerken van de oudersoort en 챕챕n of meer nieuwe kenmerken. Stel, deze soort A splitst zich ook weer in twee챘n. Opnieuw zijn de nieuwe soorten (zogenaamde zustersoorten), die wij voor het gemak B en C noemen, een mengelmoes van kenmerken van zichzelf en van oudersoort A. De kenmerken die van de oudersoort overgaan op de nieuwe soorten worden ‘primitief’ (of plesiomorf) genoemd, de nieuw ontwikkelde kenmerken worden ‘afgeleid’ (of apomorf) genoemd. Elke soort is dus een mengelmoes van primitieve en afgeleide kenmerken.

Afgeleide kenmerken

Stel, het proces vindt nog eens plaats: soort B splitst zich in de zustersoorten D en E, en soort C splitst zich in de zustersoorten F en G. Uit dit schema blijkt duidelijk dat D en E elkaars naaste verwanten zijn, en F en G idem. Maar dit schema kennen wij in de praktijk niet, we willen het juist reconstrueren. Het enige wat we hebben zijn de kenmerken van D, E, F en G. Deze vier soorten Het enige wat we hebben zijn de kenmerken van D, E, F en G. Deze vier soorten hebben bepaalde kenmerken gemeenschappelijk. Die zijn kennelijk afkomstig van de gemeenschappelijke voorouder A. Het zijn dus de primitieve kenmerken. Andere kenmerken komen alleen voor bij D en E, weer andere alleen bij F en G. Blijkbaar zijn dat kenmerken die in B, respectievelijk C zijn ontstaan en zijn doorgegeven aan het nageslacht. Deze afgeleide kenmerken bepalen dus dat D en E elkaars naaste verwanten zijn, en evenzo F en G.

Lang leve de computer

Het systeem met afgeleide kenmerken zou prachtig werken, als alle kenmerken slechts 챕챕n keer zouden ontstaan. Het kan echter voorkomen dat bij de bovengenoemde soorten een kenmerk alleen bij D en F voorkomt. Uit het schema weten we dat D en F geen zustersoorten zijn, en dat het gemeenschappelijke kenmerk dus valse informatie geeft. Zonder het schema weten we het echter nooit zeker. Er is wel een trucje, dat parsimonie heet. Dit houdt in, dat als je tussen verschillende mogelijkheden moet kiezen, je de eenvoudigste kiest. Als alle kenmerken op verwantschap tussen D en E wijzen en slechts 챕챕n op verwantschap tussen D en F, dan geeft volgens dit principe dat laatste kenmerk valse informatie; anders moet je veronderstellen dat alle andere kenmerken valse informatie geven. Aangezien we vaak met vele, soms wel honderden kenmerken werken, zijn er computerprogramma’s om het rekenwerk te vergemakkelijken.

Fossielen en reconstructie van de evolutie

Bij velen heerst de opvatting, dat de evolutie zonder fossielen niet valt te reconstrueren. Fossielen zijn heel belangrijk als getuigenissen van het verleden. We kunnen er bijvoorbeeld aardlagen mee dateren, voormalige verdelingen van land en zee mee uitzoeken en vroegere verspreidingen mee aangeven. Als het gaat om het reconstrueren van een stamboom hebben ze echter niet meer waarde dan een recente soort en veelal minder, omdat ze zeer onvolledig zijn. Uit het feit dat vissen eerder als fossiel optraden dan amfibieën en deze weer eerder dan reptielen, kunnen we niet afleiden dat ze uit elkaar zijn ontstaan. Om dat af te leiden moeten de kenmerken op dezelfde wijze geanalyseerd worden als bij recente soorten. Fossielen spreken tot de verbeelding, maar in de fylogenie gaat het om kenmerkanalyse en niet om verbeelding.

http://www.museumkennis.nl/nnm.dossiers/museumkennis/i001152.html

Reconstructie verspreidingsgeschiedenis

De verspreiding van een organisme is het resultaat van een proces dat duizenden of zelfs miljoenen jaren kan omvatten. Soms zijn er stille getuigen van vroegere verspreidingen in de vorm van fossielen, meestal echter tasten we in het duister. Of toch niet?
Gefossiliseerde verspreiding

Een fossiel vertelt ons niet alleen wanneer de betreffende soort (en daarmee het geslacht en dus ook de familie) leefde, maar ook waar. Dat kan op een heel andere plaats zijn dan tegenwoordig. Zo leefden er in Nederland ongeveer 300.000 jaar geleden nog nijlpaarden, terwijl deze dieren nu slechts in Afrika voorkomen. De meest treffende voorbeelden van veranderingen in verspreiding vinden we bij fossiele insecten. Vooral in Engeland, maar ook in Nederland en elders in Europa, als ook in Noord-Amerika is veel onderzoek gedaan aan fossiele insecten uit het Pleistoceen, vooral de laatste 100.000 jaar. Het kevertje Helophorus mongoliensis leefde 40.000 jaar geleden in Engeland, maar komt tegenwoordig alleen in Aziatische gebergten voor. Een ander kevertje, Micropeplus hoogendoorni, is nu typisch Siberisch, maar kwam twee miljoen jaar geleden voor in Alaska en 500.000 jaar geleden in Engeland.

Afgeleide verspreiding

Gedurende de laatste miljoen jaar ging het Noordelijk Halfrond gebukt onder verschillende ijstijden. Slechts 10.000 jaar geleden was Nederland nog bedekt met toendra. Vrijwel alle huidige soorten planten en dieren in Nederland dateren van na De flora en fauna die tijdens de hoogtepunten van de ijstijden Midden-Europa bewoonden, trokken zich bij het oplopen van de temperatuur zowel terug naar het noorden, als ook de bergen in. Waar de bergen hoog genoeg waren om aan hun koudewensen tegemoet te komen, konden ze in leven blijven. Zodoende ontstond een verspreidingspatroon van soorten die in Noord-Europa en in de bergen van Centraal- en Zuid-Europa voorkomen. Omgekeerd, vind je een soort met een dergelijke verspreiding, dan kun je er uit afleiden dat hij tijdens de ijstijden een grote, aaneengesloten verspreiding had ten zuiden van het landijs.

Verder terug in de tijd

De scheiding van planten en dieren na de ijstijden in populaties in het noorden en in zuidelijker gelegen bergen is meestal te recent om tot verschillen tussen de thans ge챦soleerde populaties te hebben geleid. Anders ligt het met populaties die veel langer geleden uiteengevallen zijn. Treffende voorbeelden vinden we in de zuidelijke continenten, die 80-100 miljoen jaar geleden nog samenhingen, maar nu ver uiteen liggen: Zuid-Amerika, Afrika, India, Australi챘 en Antarctica (tezamen Gondwana geheten). We vinden hier een patroon van geslachten of families die beperkt zijn tot twee of meer van deze continenten. Voorbeelden zijn de protea’s (Zuid-Afrika: suikerbossies), die we met name aantreffen in Afrika en Australi챘, en de loopvogels (rhea, struisvogel, emoe, kasuaris, kiwi), die recent of fossiel op de meeste delen van Gondwana worden gevonden.

Verspreiding en veranderingspatronen

Ook al weten we dat bijvoorbeeld Zuid-Amerika, Afrika en Australi챘 ooit met elkaar in contact stonden, dan weten we nog niet in welke volgorde ze van elkaar verwijderd zijn geraakt. Geologische gegevens kunnen hierbij natuurlijk helpen, maar ook biologische gegevens. Immers, als Zuid-Amerika en Australië langer met elkaar dan elk van beide met Afrika in contact zijn geweest, dan kunnen we verwachten dat de soorten van Zuid-Amerika en Australi챘 meer met elkaar verwant zijn dan met soorten uit Afrika. Zulke verwantschappen bepalen we door fylogenetisch of cladistisch onderzoek. In de zogenaamde fylogenetische biogeografie worden (fylogenetische) verwantschappen van soorten vergeleken met geologische verwantschappen van gebieden.

‘ER ZIJN GEEN TRANSITIONELE FOSSIELEN .’ (Creationistische stelling)

Een transitioneel fossiel ziet eruit alsof het uit een organisme komt dat zich tussen twee afstammingslijnen in bevindt. Het heeft enkele kenmerken van afstammingslijn A en enkele van afstammingslijn B en waarschijnlijk ook enkele kenmerken die tussen afstammingslijnen A en B in liggen. Transitionele fossielen zijn van alle taxonomische niveaus: er zijn dergelijke fossielen van organismen die zich tussen verschillende soorten in bevinden, tussen verschillende ordes etc. Idealiter dateren transitionele fossielen van tussen het eerste voorkomen van de voorouderlijke afstammingslijn en het eerste voorkomen van de ervan afstammende afstammingslijn.

De evolutietheorie voorspelt echter ook dat er fossielen gevonden kunnen worden met een transitionele morfologie van na beide afstammingslijnen. De theorie voorspelt immers niet dat een intermediaire vorm of een intermediair organisme slechts één lijn van afstammelingen kan hebben, noch dat deze intermediaire vorm moet uitsterven wanneer er een lijn van afstammelingen verder uit evolueert. Beweren dat er geen transitionele fossielen zijn, is simpelweg vals.

Sinds de publicatie van On The Origin of Species boekte de paleontologie heel wat vooruitgang en werden duizenden transitionele fossielen gevonden. Erosie en de veelheid aan omstandigheden die het ontstaan van fossielen moeilijk maken zorgen ervoor dat het fossielenrapport niet vlekkeloos is (wat het trouwens ook nooit zal zijn).

Bovendien kunnen transities tussen soorten of ordes zich voordoen binnen een kleine populatie, in een kleine regio en/of binnen een relatief kort tijdsbestek. Deze beperkingen verkleinen stuk voor stuk de kans op het vinden van transitionele fossielen. Niettemin bestaan er vele voorbeelden van mooie sequenties van transitionele fossielen. De transities van reptiel naar zoogdier, van landdier tot walvis en van aap naar mens zijn zeer goed gedocumenteerd Verkeerde opvattingen over het gebrek aan transitionele fossielen zijn ten dele het gevolg van de manier waarop we dikwijls nadenken over categorieën. Mensen geloven vaak dat categorieën zoals ‘hond’ of ‘mier’ goed van elkaar te onderscheiden en welbegrensd zijn, of dat er een soort eeuwige vorm bestaat die de categorie definieert (in de zin waarin Plato het reeds in de vierde eeuw voor onze tijdrekening bedoelde). Deze manier van denken verleidt ons tot beweringen in de aard van ‘de Archaeopteryx is 100% vogel’, terwijl deze soort zowel kenmerken van vogels als van reptielen vertoonde (en in feite zelfs meer reptiel dan vogel was). Wij mensen verdelen de natuur in categorieën, maar deze zijn artificieel. De natuur hoeft deze opdelingen niet te volgen, en doet dat ook niet. Sommige creationisten beweren dat de hypothese van het punctuated equilibrium (ontwikkeld door Niles Eldredge en Stephen Jay Gould) naar voren gebracht werd om gaten en gebreken in het fossielenbestand te verklaren. In feite werd deze hypothese voorgesteld om de relatieve zeldzaamheid van transitionele levensvormen te verklaren (dus niet hun totale afwezigheid) en om te verklaren waarom speciatie in sommige gevallen relatief snel gebeurt, gradueel in andere en in nog andere gevallen voor sommige soorten helemaal niet gebeurt gedurende een bepaalde periode. De hypothese ontkent dus in geen geval dat er transitionele sequenties bestaan. Zowel Gould als Eldredge zijn trouwens uitgesproken tegenstanders van het creationisme. But paleontologists have discovered several superb examples of intermediary forms and sequences, more than enough to convince any fair-minded skeptic about the reality of life’s physical genealogy. – Stephen Jay Gould, Natural History, Mei 1994. bron: http://www.evolutietheorie.be/

*                               

“….Elk levend organisme is tegelijkertijd een (overgangs)fossiel. Het draagt tot in de microscopische structuur van zijn proteïnen, de sporen, zoniet de stigma’s van zijn voorouders…” Jacques Monod
NaDarwin
Introductie tot het fossielenbestand
Over fossielen in het algemeen, een beknopte verhandeling over het fossielenbestand en hoe dit een bewijs voor evolutie vormt.
Een artikel van Tim Spaan, met bijdrages van Bart Klink, Lars Brugman, Thomas de Wilde en Fedor Steeman.
Het fossielen bestand, samen met ‘fossielen archief’ of ‘fossielen kolom’ een ietwat klunzige vertaling van het Engelse fossil record, is de benaming voor alle gevonden fossielen. Doordat fossielen als één van de weinige elementen in de natuur ons iets kunnen zeggen over natuurlijke historie zijn fossielen van groot belang als ondersteunend, of afwijzend bewijsmateriaal voor een leer of wetenschappelijke theorie die het ontstaan en/of ontwikkeling van het leven op aarde beschrijft. De evolutietheorie is zo’n leer en vandaar dat een groot gedeelte van deze website hieraan is gewijd.Allereerst:
moeten we ons realiseren dat een uiterst klein aantal dieren en planten die in lang vervlogen tijden hebben geleefd het geluk hebben om als fossiel geconserveerd te blijven. Het aantal gevonden fossiele soorten bedraagt op dit moment zo’n 250.000, verspreid over de 1700 miljoen jaar durende natuurlijke historie. Terwijl alleen vandaag de dag al zo’n 1,5 miljoen levende soorten bekend zijn. Dit verschil wordt voornamelijk bereikt doordat kleine ongewervelde dieren zoals insecten en dergelijke in zulke kolossale aantallen en variaties leven, maar door hun kleine lijfjes en gebrek aan stevige massieve structuren een zeer kleine kans hebben om daadwerkelijk geconserveerd te worden. Grotere dieren, met sterke in -of uitwendige skeletten worden meer gevonden, en laten dikwijls ook andere sporen achter, zoals voetsporen en mest. Het fossielenbestand is hoe dan ook in het algemeen geen accurate weerspiegeling, al zijn er uitzonderlijke situaties waarin paleontologen het geluk hebben een volledig versteend prehistorisch ecosysteem terug te vinden, zoals bij vondsten nabij het Duitse Messel, het Canadese Burgess Shale en het Californische La Brea. Maar gewoonlijk zijn de gevonden fossielen slechts fragmenten van de werelden waar zij eens deel van uitmaakten.
Toch mogen we niet klagen over de onvolledigheid van het fossielenbestand, daar het plaatje de afgelopen driehonderd jaar al aanmerkelijk duidelijker is geworden. Rond de tijd dat de eerste revolutionaire biologen opstonden en hun ideeën over een gemeenschappelijke oorsprong in de wereld hielpen bestond het fossielenbestand nog slechts uit wat botten van voorhistorische wezens die sporadisch over de wereld waren gevonden. Merkwaardige dieren waar niemand een touw aan kon vastknopen zoals de in Limburg gevonden Mosasaurus, de Britse Ichtyosauriërs of de reusachtige Zuid-Amerikaanse Megatherium en Toxodon. Allen waren vreemde, voorwereldse dieren, waarbij in sommige gevallen nog overeenkomsten met tegenwoordige dieren te bespeuren vielen, zo werd Megatherium al vrij snel herkend als een terrestrische luiaard, ter grote van een olifant, maar vele anderen waren volslagen onbekend en hadden voor pre-Darwiniaanse begrippen ook een zeer raadselachtige lichaamsbouw. Waarom had Ichtyosaurus, een zeereptiel, zo’n sterk visachtig lijf, waarom had God niet meteen een gewone vis geschapen?
Ondanks dit soort vragen konden fossielen de schepping niet in twijfel trekken, de evolutietheorie des te meer, want hoewel er vele fossielen van uiteenlopende dieren werden gevonden, zoals dinosauriërs, mammoeten, vreemde Zuid-Amerikaanse zoogdieren, zeereptielen, vleermuisachtige vliegende reptielen, en vele ammonieten, schaaldieren die in de Britse folklore al eeuwen bekend stonden als ‘slangestenen’, werden er maar weinig fossielen gevonden van de dieren die er volgens de evolutietheorie moesten zijn, namelijk overgangsvormen die kenmerken van verschillende diergroepen vertonen. De in 1861 gevonden gevederde Archaeopteryx mag een uitzondering heten. Darwins bewijzen voor evolutie bestonden voornamelijk uit rudimentaire organen, geografische spreiding van bepaalde dieren zoals Buideldieren, en de rechtstreekse waarneming van micro-evolutie, zoals de Darwin-vinken. Darwin vermelde in zijn boek het zelfde als ik nu, dat het fossielenbestand zeer onvolledig was, maar met meer ernst daar het in zijn tijd nog vele malen onvollediger was, en argumenteerde dat overgangsvormen (nog) niet bekend waren omdat deze nog niet waren gevonden, of misschien wel helemaal niet bewaard gebleven, daar fossilisatie een zo’n zeldzaam proces is en slechts een zeer beperkt aantal dieren bewaard blijft.
Maar sindsdien is er veel veranderd, en tegenwoordig kunnen we ons beroepen op het fossielenbestand om bewijs te krijgen voor macro-evolutie, maar voor ik aan dit onderwerp begin vertel ik eerst hoe het proces van fossilisatie in zijn werk gaat. Hoe wordt een fossiel gevormd?
Fossielen zijn versteende overblijfselen van organisch materiaal, die ontstaan waarneer mineralen in de grond door bijvoorbeeld een dinosaurusbot worden geabsorbeerd. Het bot of ander lichaamsdeel dat wordt versteend moet dus bedekt zijn met mineraalhoudende aarde of modder. Deze verstening kan plaatsvinden binnen enkele uren tot een paar duizend jaar. Belangrijk is dat het een zuurstofarme omgeving moet zijn, want in een zuurstofrijke omgeving krijgen micro-organismen de kans om energie te onttrekken aan de organische stoffen, waarbij zelfs de harde botelementen wegrotten. Fossielen worden dus meestal gevormd in waterrijke omgeving. Andere mogelijkheden zijn woestijnachtige gebieden of veenmoerassen. In de meeste gevallen krijgen bacteriën toch de kans om de zachte delen van een kadaver te laten ontbinden, waardoor gefossiliseerde organen, vacht of maaginhoud slechts heel zelden worden gevonden. Een andere mogelijkheid van fossilisatie is dat de botelementen daadwerkelijk wegrotten, maar in de hardgeworden modder een mal achterlaten die dan opnieuw met mineralen en gesteenten wordt opgevuld. Dit proces heet het “Cast en Mould” principe, waarbij op natuurlijke wijze een kopie van het oorspronkelijke fossiel wordt gemaakt. Dit kan alleen voorkomen in sedimentaire gesteenten, die ongeveer 25% van de aardkorst uitmaken. Bijzonder is wel dat deze mallen soms worden opgevuld met zeldzame gesteenten, zo zijn er in Australië fossielen gevonden die uit Opaal bestaan, en in Canada werden dinosaurusbotten van Pyriet gevonden.
Naast een zuurstofarme omgeving is er nog een vereiste voor het fossilisatieproces, namelijk dat de organische stoffen snel moeten worden bedekt met modder, zand of afgekoelde lava zodat de mineralen kunnen binnendringen. Eén van de beste methoden waarop dat gebeurd is drijfzand, waar dieren in vast komen te zitten en wegzinken in de bodem. Een vergelijkbare methode is bij meertjes waar op natuurlijke wijze asvalt wordt gevormd, zoals in het Californische la Brea. Maar gewoonlijk worden fossielen begraven door het aangevoerde sediment in rivieren. In rivieren eroderen de oevers aan één kant van een bocht en wordt het sediment weer opgeworpen aan de andere kant van de bocht, waardoor deze scherper wordt. Hierdoor ontstaat een typisch kronkelpatroon, waarbij een grote rivier op sommige plaatsen vele kilometers verschuiven. Als er zich tussen het sediment organische resten (zoals botten) bevinden kunnen deze snel bedekt worden onder het sediment en fossiliseren. We weten dat dit waar is omdat grote aantallen fossielen vaak worden gevonden in scherpe bochten van wat destijds grote rivieren waren, bijvoorbeeld in Patagonië, bij de vindplaats van Giganotosaurus en Argentinosaurus. Zulke dieren zouden misschien zijn verdronken bij het oversteken van de rivier, zoals ook tegenwoordig nog dikwijls verschillende gnoes verdrinken waarneer de kudde haastig een snelstromend water oversteekt.
Een andere veel voorkomende manier waarop fossielen worden gevormd is door een plotselinge regenbui na een lange droogte. Net als tegenwoordig werden vroeger veel gebieden de ene helft van het jaar blootgesteld aan een tijd van droogte, het droge seizoen, en de ander helft van regens, het natte seizoen. Tegen het eind van het droge seizoen droogde zelfs de laatste poeltjes en riviertjes op, en dieren die hier kwamen zoeken naar drinkwater stierven dan van de dorst in het opgedroogde meer of rivierbedding. Waarneer het natte seizoen dan vervolgens aanbrak werden deze weer snel gevuld met water, en de dode lichamen die er in lagen werden bedekt met modder en sediment, waardoor ze fossiliseerde. Hierdoor vinden we veel skeletten, bijvoorbeeld in de Noord-Amerikaanse Morrison Formation, liggend in wat vroeger meertjes of rivierbeddingen waren. Onder andere het befaamde Allosaurusskelet Big Al, is op die manier gefossiliseerd.
Dat er bij fossilisatie vaak water aan te pas komt wil niet zeggen dat dit essentieel is, het gaat er ten slotte om dat er weinig zuurstof aanwezig is die bacteriën in leven houdt die aan het kadaver knagen, en dat kan ook voorkomen in heel droge omstandigheden. De fossielen uit Mongolië, zoals van Velociraptor en Protoceratops tijdens het late-Krijt hebben hun conservering te danken aan het zand dat hun lichamen bedekte, waarschijnlijk tijdens een zandstorm.°
Behalve deze gangbare fossilisatiemethodes zijn er nog uitzonderlijke situaties waarbij een dood lichaam extreem goed geconserveerd wordt, bijvoorbeeld doordat het wordt bedekt met vloeibare boomhars. Waarneer deze stroperige substantie opdroogt wordt het keihard (Dit noemen we barnsteen of amber.), en alles wat zich hierin bevind wordt volledig afgesloten van de buitenwereld en perfect geconserveerd. Helaas kunnen alleen kleine dieren volledig bedolven worden onder de boomhars, dus de dieren die zo bewaard blijven zijn insecten, spinnen en ander klein gedierte.°
Ook is er een fossilisatiemethode waarmee we geluk hebben dat we leven in een periode waarbij we net een ijstijd achter de rug hebben. Tijdens de ijstijd zijn verschillende grote dieren waaronder mammoeten door het ijs van lichtbevroren poelen gezakt. Waarneer de poel of meertje dan geheel bevroor werden de dode lichamen geconserveerd als in een natuurlijke diepvries. Sinds de ijstijd is het al veel minder koud, maar toch vinden we in Siberië en Noord-Canada soms de bevroren lijken, men spreekt van ijsmummies, van deze dieren terug, zoals Dima, de babymammoet. Ook werd in een gletsjer in Oostenrijk de beroemde ijsmummie ‘Ötzi’ terug gevonden, een man van ongeveer 5000 jaar oud, geconserveerd in het ijs.°Tenslotte zijn zuurstofarme veenlagen geschikt voor fossilisatie, in Europa en Noord-Amerika zijn een kleine 500 menselijke veenlijken gevonden,waaronder het Nederlandse ‘meisje van Yde’

°

veenlijken°http://www.schooltv.nl/beeldbank/clip/20101215_offeraandegoden01°Verschillende soorten fossielen, versteende botten van een Maiasaurus, het ingevroren lichaam van
‘Dima’ een babymammoet,http://rockglacier.blogspot.be/2008/10/mammoth-mummies-mystery.htmlFig. Dima , a 4-6 month old Mammoth calf, considered the best preserved specimen

 

°

9300 jaar oude ingevroren bizon ontdekt in Siberië

 

Wetenschappers hebben de meest complete ingevroren steppenwisent ooit ontdekt. Ze deden hun ontdekking in Siberië, waar ze het complete, ingevroren lijf vonden van een bizon die zo’n 9300 jaar geleden leefde en tot een soort behoort die inmiddels is uitgestorven.

°

De onderzoekers hebben de bizon voorzichtig uit het ijs gehaald en aan een grondige analyse onderworpen. Het blijkt te gaan om een steppenwisent (Bison priscus). Net als veel andere grote zoogdieren stierf deze soort enige tijd nadat de IJstijd ten einde kwam (rond 11.000 jaar geleden) uit. Hoewel de bizon die de onderzoekers nu ontdekt hebben al zo’n 9300 jaar dood is, is zijn lijf nog in redelijke staat. Het brein, hart, de bloedvaten en het spijsverteringssysteem is nog helemaal intact. Wel zijn sommige organen door de tijd heen flink gekrompen.

Doodsoorzaak
De onderzoekers hebben natuurlijk ook geprobeerd om de doodsoorzaak van de bizon te achterhalen. Ze konden geen afwijkingen in de anatomie van het dier ontdekken. Wel zagen ze dat het dier weinig vet rond zijn buik had zitten. Dat zou erop kunnen wijzen dat het dier door honger om het leven is gekomen.

Goede vondst
Wetenschappers zijn in hun nopjes met de vondst. “Omdat deze bizon zo goed bewaard is gebleven kunnen we de anatomie vergelijken met de anatomie van moderne soorten bizons en vee en met de anatomie van uitgestorven bizons die op de grens tussen het Pleistoceen en Holoceen verdwenen,” legt onderzoeker Evgeny Maschenko uit.

Het onderzoek naar de ingevroren bizon gaat nog wel even door. Zo zullen onder meer de botten, tanden en parasieten in het lijf van de bizon nog aan een grondige analyse onderworpen worden. Zo hopen de onderzoekers de exacte doodsoorzaak te achterhalen, maar ook meer te weten te komen over het gedrag van deze bizon en de oorzaken van het uitsterven van de soort.

°

Bronmateriaal:

Complete 9,000-year-old frozen bison mummy found in Siberia

– Society of Vertebrate Paleontology

(via Sciencedaily.com)

 

°

amberant1sen een perfect geconserveerde mier in een fraai stukje barnsteen.

 

°

Het fossielenbestand als bewijs voor macro-evolutie.
De mate waarin een dier, zijn familie en/of voorouders in het fossielenbestand zijn vertegenwoordigd verschilt per familie, genus, soort, maar ook wat betreft levenswijze. Walvissen bijvoorbeeld, zijn grote dieren met zware botelementen, die leven in waterrijk gebied, bijna alles aan hen maakt hen geschikt voor fossilisatie. Aan de ander kant echter zijn er bijvoorbeeld vleermuizen, die beschikken over zeer lichte fragiele botjes, en leven in grotten en bomen, ver weg van het water.

 

 

 

 

…..Walvissen worden  in overvloed  gevonden, maar vleermuizen zijn bar slecht vertegenwoordigt in het fossielenbestand en over hun evolutie valt nauwelijks tot niks te zeggen.

Walvissen en vleermuizen zijn twee extreme voorbeelden, maar voor het gehele fossielen bestand geldt dat grote dieren en waterdieren een betere kans hebben tot fossilisatie dan kleine dieren en landdieren.

Een voorbeeld hiervan is dat mensen bij dinosauriërs altijd denken aan enorme woeste reptielen, terwijl de meeste dinosauriërs niet groter waren dan een koe of iets dergelijks. De grote soorten zijn echter veel beter en vaker bewaard gebleven en worden vaker gevonden. Een ander voorbeeld, over de omgeving, is dit: binnen de familie Mustelidae (Marterachtigen) zijn zowel terrestrische soorten (wezels, hermelijnen, dassen.) als aquatische (otters). De enige Musteliden die redelijk vertegenwoordigt zijn in het fossielen bestand zijn de otters, doordat die in de buurt van rivieren leven en een grotere kans hebben om na hun dood door sediment te worden bedolven. Ten slotte werd aan het begin van dit stuk al opgemerkt dat insecten door hun kleine formaat en lichaamsstructuur niet overvloedig voorkomen in het fossielen bestand, in ieder geval niet in verhouding tot hun aantallen in een gewoonlijk ecosysteem.
Het is dus zonneklaar dat het fossielenbestand op sommige vlakken onvolledig is, en als gevolg hiervan kunnen we van sommige diersoorten moeilijk zeggen hoe hun evolutie zich heeft afgespeeld, of daarvan zelfs nauwelijks afleiden dat deze heeft plaatsgevonden, zoals in het geval van vleermuizen. Het is echter redelijkerwijs unfair om op basis van alleen vleermuizen vast te stellen dat het fossielen bestand geen aanwijzingen of bewijs voor evolutie levert, want er zijn ook een groot aantal vlakken waarop het plaatje veel completer is, zelfs zodanig dat de evolutie op de voet te volgen valt, zoals bij paarden, walvissen, zoogdierachtige reptielen en hominiden, waaraan de overige artikelen in dit hoofdstuk zijn gewijd.
Als we ons beeld op het fossielenbestand wat verruimen, zien we dat elke twijfel over evolutie uitgesloten is. Waarneer we een verzameling fragmenten nemen van de werkelijkheid kunnen we die makkelijk ‘herinterpreteren’ tot een bewijs tegen evolutie, of een bewijs voor de onwaarschijnlijkheid daarvan. Als we echter het hele plaatje bekijken, zien we dat de enige redelijke verklaringen diegenen zijn waar de huidige wetenschap dan ook mee komt (evolutie).

Een fossiel zeedier uit het Precambrium, Dickinsonia.
Het is niet bekend of dit dier kon zwemmen
ofzich gewoon over de zeebodem voortbewoog.

Een beknopt overzicht over 3,5 miljard jaar.
Tegen het licht gehouden van uit welke tijd de verschillende gevonden fossielen stammen (Over de integriteit van dateermethodes gaat dit hoofdstuk.) zien we dat een geleidelijke ontwikkeling en gemeenschappelijke oorsprong niet meer dan de enige verklaring is. In de alleroudste aardlagen, die van het Precambrium, tot 3,5 miljard jaar geleden worden enkel microfossielen aangetroffen, gevormd door ééncelligen. In Australie is eens een 3,45 miljard jaar oude stromatoliet, een pilaarachtige kolonie van eencelligen gevonden. maar verder was het enige leven op aarde niet groter dan een bacterie.
Multicellulaire (meercellige) dieren treffen we aan in het late Precambrium. Vanaf 680 miljoen jaar geleden zien we voor het eerst sporen van gravende dieren, mogelijk wormachtige wezens. Hun fossielen zijn nooit gevonden, maar hun tunneltjes wel. Vanaf 610 miljoen jaar geleden verschijnen de eerste vormen van wat we de Ediacaran of Vendian fauna noemen, kleine kwal -en wormachtige zeedieren. Sommige waren filtervoeders, die aan een rots waren vastgeketend en viste voorbij komende eencelligen uit het water. Veel dieren uit deze periode hebben voor zover we kunnen zien geen orale en anale lichaamsopeningen en geen maag. Hun voedsel werd waarschijnlijk verwerkt door bacterieen die zich in hun lijf bevonden. Ook afwezig zijn alle sporen van ogen, oren, reukzin, poten en hersens, hun enige zintuig was tastzin.
Vanaf 570 miljoen jaar geleden ontstonden de eerste Brachiopoden (Schelpdieren), deze ontwikkelden hun beschermende schaal tegen roofdieren, maar deze ontwikkelde op hun beurt een drilboorachtig orgaan om de schelp te doorboren. De oudste schelpen vertonen al gaatjes veroorzaakt door deze roofdieren, en tot vandaag de dag gaat dit door.

Een Brachiopode. Platystrophia ponderosa. Brachiopods are marine invertebrates with two dissimilar shells. They are very common in Paleozoic strata (especially in Ordovician, Silurian, Devonian and Mississippian rocks in Kentucky). Shells may be replaced with either calcite or quartz. Generally, the size of the fossils are less than 2 inches in width.

De ‘Cambrische explosie’.

Met het binnentreden van het Cambrium namen de aantallen en de variatie binnen de fossielen snel toe, zodanig dat men rond het begin van de 20ste eeuw  Sinds er nieuwe fossielen zijn gevonden weet men
dat het Cambrium heel wat minder explosief was dan men aanvankelijk dacht, maar het blijft een periode waarin de soortvorming en variatie op een hoger pitje stond dan normaal. In de 518 miljoen jaar oude lagen van wat tegenwoordig de Burgess Shale heet worden vele fossielen van de vreemde voorwereldse dieren uit het Midden-Cambrium gevonden. De meeste van hen zijn geleedpotigen, zoalsMarellaAnomalocaris en vroege Trilobieten bijvoorbeeld Naraoia. Ook waren er wormen, bijvoorbeeld Canadia, en dieren die over zulke vreemde kenmerken beschikken dat niemand er een touw aan kan vastknopen, zoals de vijfogige, en van een slurf voorziene Opabinia.
Zeer belangrijk is de vondst van Pikaia, een 5 centimeter lang aalachtig diertje dat de eerste sporen van een ruggengraat vertoont.

Na het Cambrium volgde het Ordovicium, dat liep van 490 tot 443 miljoen jaar geleden. Rond 445 voltrok zich een massa-extinctie, die alleen wordt overtroffen door de Perm-Trias extinctie. De meest waarschijnlijke oorzaak hiervan was een ijstijd. Tijdens het Ordovicium ontwikkelden zich de eerste echte gewervelde. Dit waren de Agnatha, vissen zonder kaken of vinnen, maar het een benig koppantser, ze leken op 10 centimeter lange gepantserde kikkervisjes. Anders dan in latere perioden waren gewervelde niet de meest opvallende levensvorm. De vissen konden zich niet ontwikkelen tot roofdieren vanwege een gebrek aan kaken, in plaats daarvan voedde ze zich met organisch afval op de zeebodem. De echte roofdieren waren de Euryteriden oftewel de zeeschorpioenen, verwanten van spinnen en schorpioenen, die soms een meter tot twee meter lang werden en voorzien waren van pantsers en machtige scharen om hun prooi aan repen te scheuren. Daarnaast waren er verschillende soorten cephalopoden, ongetwijfeld de meest indrukwekkende soorten weekdieren, waar de hedendaagse octopussen en inktvissen toe behoren. In vroegere tijden waren er nog meer soorten van deze dieren met hun bewegelijke vangarmen, zoals belemnieten, Ammonieten en Orthoceren. Orthoceren leken ongeveer op pijlinktvissen, behalve dat hun lange achterlijf in een grote schelp was verborgen. Het waren onmiskenbaar roofdieren, die door gassen in of uit hun schelp te lopen konden stijgen en dalen in het water. Met hun tentakels grepen ze prooien van de zeebodem en beten deze in stukken met hun harde snavelachtige bek. De meeste orthoceren waren klein, maar er is een monsterachtige grote Orthoceer uit het Ordovicium bekend, de minstens 10 meter lange Cameroceras.

Trilobiet

Tenslotte floreerden Trilobieten in het Ordovicium, evenals de Agnatha leefde zij van organisch afval op de zeebodem, en dit was een zeer succesvol bestaan, Trilobieten zijn veelvuldig bekend uit het Cambrium, Ordovicium en Siluur, vanaf het Devoon begonnen ze in aantal af te nemen en stierven definitief uit aan het einde van het Perm. Maar bij elkaar hebben ze ruim 300 miljoen jaar bestaan, en momenteel zijn er zo’n 15000 verschillende soorten bekend. Sommige Trilobieten konden vrij zwemmen, andere kropen alleen over de zeebodem en/of groeven zich in in de bodem. Sommige hadden lange voelsprieten, of ogen op steeltjes, die ze boven het zand uitstaken als ze zich hadden ingegraven. De meeste trilobieten waren enkele centimeters lang, andere bereikte een lengte van een halve meter.

°

euripide Sea-Scorpion

Eurypide

zeeschorpioen 

Na het Ordovicium volgde het Siluur, de omstandigheden waren niet veel anders dan in het Ordovicium. Nog steeds leefde er Trilobieten, Agnatha en zeeschorpioenen.

Rond deze tijd leefde er ook Graptolieten, een diersoort die in kolonies leefde zoals het tegenwoordige Portugees oorlogsschip. Deze parapluachtige kolonie werd gevormd door verwanten van de gewervelde, de chordaten, die als larve een klein ruggengraatje bezitten en als volwassenen zich vastklampen aan een rots of in dit geval aan elkaar.
Bijzonder is dat tijdens het Siluur de eerste vissen kaken ontwikkelden. Kaken waren al eerder uitgevonden door verschillende diergroepen, maar tot nog toe hadden de gewervelde verstek laten gaan. Rond 435 miljoen jaar geleden vormden enkele vissen de voorste bogen van hun kieuwskelet om tot een soort bijtorgaan, waarop tanden groeiden. Met deze wapens konden vissen de rol van toproofdieren overnemen, want anders dan de geleedpotigen en cephalopoden beschikte vissen over de juiste lichaamsbouw om snelheid te ontwikkelen, en hierdoor namen vissen vrij snel de wereld over.
bothriolepisDe Placoderm Bothriolepsis

Dit gebeurde met het binnentreden van het Devoon, tijdens deze gouden eeuw van de vissen werden verschillende andere diersoorten verdrukt door deze nieuwe vormen van roofdieren. Zo verdwenen met het Devoon 4 ordes van trilobieten (Alleen de orde der Proetida overleefde.), de meeste kaakloze vissen (Er bestaan vandaag de dag nog twee soorten, die een aasetend bestaan leiden.), de Orthoceren verloren hun plaats aan de top van de voedselketen, en de schorpioenen en spinnen werden het land op gedreven. De wapenwedloop in zee was definitief gewonnen door de vissen, en dit is nog steeds merkbaar tot vandaag de dag.
In het Devoon verschenen de eerste van wat een uiterst succesvolle familie van roofvissen zou worden, de haaien, maar in het Devoon stonden deze nog in de schaduw van de gepantserde Placodermen. Enorme Placodermen zoals Dunkleosteus maakten de zee onveilig, en maakte van hun nieuwe bijtgereedschap gebruik om andere vissen te bejagen. Anders dan de zeeschorpioenen en Orthoceren waren zij snelle jagers, die hun prooi bliksemsnel konden grijpen met een krachtige zwaai van hun staart. Andere groepen vissen waren de spiervinnigen, die zich met name ophielden in zoet water, waarvan enkele zeer benige vinnen ontwikkelden zoalsEusthenopteron. Een weinig later ontwikkelden ze ook nog eens vingers, en hierdoor waren enkele spiervinnigen in staat om voor het eerst het water te verlaten en een kijkje boven water te nemen. Zulke vissen met poten zoals Acanthostega openden de evolutionaire deur richting het vasteland.

Hierna volgde het Carboon, genoemd naar de steenkoollagen die uit deze tijd stammen. Het Carboon is inmiddels verdeeld in twee tijdperken, het Mississipian en hetPennsylvanian. Gedurende deze tijd ging het bergafwaarts met verschillende groepen vissen, ten gunste van een succesvolle groep, de straalvinnigen. Hiertoe behoren bijna 90% van de huidige vissen, en dit succes ging ten koste aan de Placodermi, die geheel uitstierven en de spiervinnigen, waarvan enkel nog wat longvissen en de Coelacanth toe behoren.
 


Van de oude vissoorten zijn alleen de haaien er nog redelijk van af gekomen.
Ondertussen zat het leven op het land ook niet stil, uit halfaquatische amfibieen hadden zich volledig terrestrische reptielen ontwikkeld, die zich aangepast hadden aan een leven op het land. Deze ontwikkeling ging overigens niet zo heel vlot, het eerste echte reptiel ontstond pas tegen het einde van het Pennsylvanian.
In het Perm kwamen de landdieren pas tot ontwikkeling. Het meest prominent waren de Synapside reptielen, die zich ontwikkelden tot zowel herbivoren als carnivoren, tot deze familie behoort onder meerDimetrodon.

De Synapside Dimetrodon

Tegen het einde van het Perm deed zich een verwoestende ramp voor, die bijna 90% van het leven op aarde vernietigde. Hoewel het leven daarna in eerste instantie weer verder ging alsof er niets gebeurd was stonden er toch veranderingen op tilt. Met het binnenkomen van het Trias ontwikkelde zich een andere familie van reptielen, de Archosauriërs. Deze familie bracht verschillende uiterst succesvolle diergroepen voort, zoals krokodillen, pterosauriërs en dinosauriërs. Samen met verschillende soorten marine reptielen, zoals ichtyosauriËrs en plesiosauriërs, beheerste zij de rest van het Mesozoïcum. In deze perioden leefde vele van de grootste dieren die de wereld ooit gezien heeft.
Maar hoe machtig de dinosauriërs en hun verwanten ook waren, ze verdwenen van de aardbodem (Met uitzondering van de krokodillen en vogels.) tijdens de overgang van het krijt naar het Tertiair.
Sinds het Trias waren veel van de Synapsiden verdwenen, maar helemaal uitgestorven waren ze niet. Ze overleefden het Mesozïccum, maar waren hierdoor alleen wel onherkenbaar veranderd in wat we tegenwoordig zoogdieren noemen.

 

Nu de Archosauriërs uit de weg waren konden de zoogdieren hun kans grijpen en namen de wereld over. Waar ze ook kwamen paste ze zich aan, zo ontstonden er aquatische zoogdieren zoals walvissen en zeeleeuwen, in bomen levende intelligente primaten, kleine knaagdieren, forse planteneters en snelle roofdieren. Ze deelden hun wereld met vogels, die afkomstig waren van dinosauriërs die rond het Jura en krijt experimenteerde met een bepaalde soort van huidbedekking, die we tegenwoordig veren noemen. Rond 8 miljoen jaar geleden zette de primaten de eerste stap richting mensheid, door rechtop te gaan lopen en hun handen te gebruiken voor nuttiger doeleinden. Na verloop van tijd gaven zij gestalte aan de mens van vandaag de dag, en hiermee eindigt het fossielen bestand.

 

Bewijzen met een onvolledig fossielenbestand.
Het valt niet te ontkennen dat het fossielenbestand een ontwikkeling van simpel naar geavanceerd weergeeft. Als je een modern dier als een hond (Canis) vergelijkt met een dier uit het Precambrium, bijvoorbeeld Dickinsonia, is de eerste een space shuttle en de tweede een ossenkar. Probleem is echter wel dat we niet de exacte evolutionaire lijn kunnen reconstrueren, we hebben niet genoeg fossielen om een vloeiende lijn van Dickinsonia naar Canis te creëren. We beschikken hooguit over de helft van alle schakels die in zo’n lijn behoren, maar hiermee kunnen we nog wel afleiden dat er zich een evolutie heeft plaatsgevonden. Om dit duidelijker te maken maak ik gebruik van een analogie met een autorit:

°

Onder evolutie versta ik de geleidelijke ontwikkeling van eenvoudig leven naar complex leven. De autorit gaat van zijn beginpunt (Apeldoorn) naar zijn eindpunt (Den Haag). Onderweg zal in Amersfoort en in Utrecht een foto van de auto gemaakt worden en de tijd opgenomen worden.

De autorit staat in deze analogie voor het evolutieproces. Het beginpunt (Apeldoorn) staat voor het eerste, eenvoudige leven. Het eindpunt (Den Haag) staat voor het huidige, complexe leven. De foto staat voor een gevonden fossiel (waarneming van de locatie). De opgenomen tijd staat voor de datering van het fossiel (waarneming van ouderdom).

Op tijdstip 00.00 vertrekt de auto vanuit Apeldoorn en wordt er een foto gemaakt.
Op tijdstip 00.30 wordt er een foto gemaakt van de auto in Amersfoort.
Op tijdstip 00.45 wordt er een foto gemaakt van de auto in Utrecht.
Op tijdstip 01.30 komt de auto aan in Den Haag en wordt er een foto gemaakt.

Door de te kijken naar sequentie van de tijd kan worden geconcludeerd dat de auto van Apeldoorn naar Amersfoort is gereden in een tijdspanne van 01.30 uur. Naar de analogie vertaald is er dus een evolutie geweest van eenvoudig naar complex. De foto’s van de auto in Apeldoorn, Amersfoort, Utrecht en Den Haag zijn hier het bewijs van. Naar de analogie vertaald zijn er dus fossielen gevonden in verschillende stadia van de evolutie van eenvoudig naar complex.

  • Is het nu nodig om van elke meter die de auto heeft afgelegd een foto te maken en de tijd op te nemen, om te kunnen concluderen dat de auto van Apeldoorn naar Den Haag is gereden? Naar de analogie vertaald: is het nodig om van elke tussenvorm een fossiel te vinden, om te kunnen concluderen dat er evolutie heeft plaatsgevonden? Het antwoord op deze vraag is Nee. De foto en de tijdopname zijn al voldoende om de conclusie te trekken dat de auto van Apeldoorn naar Den Haag is gereden. Met andere woorden: als men fossielen (‘foto’s’) heeft gevonden dat eenvoudige organismen zich in ouder lagen bevinden dan complexere organismen, is dit voldoende om te concluderen dat er evolutie is.

Het bovengenoemde bewijs geeft niet precies langs welke weg (via welke overgangsvormen) de evolutie heeft plaatsgevonden, het geeft slechts bewijs dat er evolutie is. Hoe meer foto’s er onderweg gemaakt worden, hoe exacter de weg, waar langs de autorit heeft plaatsgevonden, bepaald kan worden. Dus hoe meer fossielen er gevonden worden, hoe nauwkeuriger de exacte weg van het evolutieproces bepaald kan worden. Het fossielenbestand is nog steeds niet geheel compleet, omdat vele fossielen nog ontdekt moeten worden of niet ontdekt kunnen worden. Dit getuigt dus niet van een weerlegging van evolutie. Dit vormt slecht een belemmering in het ontdekken van de exacte weg van het evolutieproces, niet in het feit of er evolutie is.

Creationisme?
Doordat er maar zelden sprake is van een plotselinge verschijning van organismen in het fossielen bestand, en er een legio fossiele dieren zijn gevonden die de afgebakende grenzen tussen verschillende diergroepen doen vervagen (Zoals AcanthostegaWestlothianaCynognathusArchaeopteryx, enz.) is de enige kans voor een creationist om evolutie tegen te spreken het fossielen bestand anders te interpreteren. Hun doel is om aan te tonen dat de prehistorische dieren niet in verschillende tijden leefden, zoals het fossielenbestand doet vermoeden, maar allen ter zelfde tijd leefden, hooguit zo’n 6000 jaar geleden. Dit is al onwaarschijnlijk om de reden dat volgens deze hypothese bijvoorbeeld dinosauri�rs en mensen samen zouden moeten hebben geleefd. En een prehistorische mens bij het kuieren door het bos de kans liep een T-rex tegen te komen. Waarschijnlijk zou het menselijke ras nooit zo succesvol zijn geworden als ze hun wereld zouden moeten delen met monsters als Giganotosaurus enUtahraptor. Dit doet al een flinke afbreuk aan de geloofwaardigheid van het Young-earth creationisme. Maar om te proberen het fossielen bestand te herinterpreteren heeft men de volgende hypothese bedacht:

Alternatief -?- voor de geologische tijdschaal.
De aardlagen zoals die worden weergegeven zijn niet ontstaan onder invloed van erosie en sedimentering naarmate de tijd verstrijkt, zo zegt men, maar ontstaan door een wereldwijde overstroming, die in de Bijbel beschreven staat als ‘de zondvloed’. Hierbij stuiten de argumenten al over drie struikelblokken. Ten eerste spreekt deze hypothese de dateermethodes tegen, tot nu toe is er nog nooit een dier ouder gedateerd dan een dier dat in oudere lagen is gevonden, tenzij hier een plausibele verklaring voor te vinden viel (Bijvoorbeeld de Belgische Iguanodons die in Carboonlagen (Een steenkoolmijn) zijn gevonden, deze lagen tussen de Krijt-sedimenten waarmee ze samen uit jongere lagen zijn komen vallen.), tevens is het argument ad-hoc, wat wil zeggen dat het is ontworpen om één probleem op te lossen en verder niet door samenhangende argumenten wordt ondersteund. Ten slotte is er nergens in de geologische lagen een spoor van een wereldwijde vloed te vinden, wel lokale overstromingen, maar een wereldwijde vloed wordt tegengesproken door een legio aanwijzingen zoals:

  • Zoutafzettingen tussen de verschillende aardlagen, deze ontstaan door regelmatige uitdrogingen.
  • Een kilometers dikke sliplaag, ontstaan door de wereldwijde modderpoel die het water veroorzaakte, is nergens te vinden.
  • Een genetische bottleneck (omdat van alle diersoorten er 2 of 7 aan boord van Noach’s ark waren.) bij alle diersoorten op het zelfde ogenblik, wordt niet waargenomen.
  • Sporen van een grote hoeveelheid water van zo’n vierduizend jaar geleden zouden gevonden moeten worden in ijskappen op Groenland en fossiele boomstronken. Met de moderne wetenschap kan men al kleine locale klimaatsveranderingen waarnemen, bijvoorbeeld plaatselijke overstromingen of droogteperiodes die zich bijvoorbeeld 1500 of 2000 jaar geleden hebben afgespeeld. Een wereldwijde vloed, die “zelfs de hoogste bergen zou overspoelen” zou zo’n impact op de wereld achterlaten dat die gemakkelijk zou zijn op te sporen.Nog een groot aantal andere argumenten tegen een vloed kunnen hier worden gevonden.Dus alleen waar het de zondvloed betreft roept deze hypothese al meer vragen dan antwoorden op, maar hij gaat helemaal de mist in bij het verklaren waarom complexe dieren bovenaan in de aardlagen liggen en simpele onderaan:
  • Eencellige zijn de enige dieren die zo diep in de grond kunnen leven.
  • Vissen zwemmen in de zee en als de samenstelling van zeewater veranderd zijn zij de eersten die sterven.
  • Landdieren leven op land en als het water stijgt verdrinken ze.
  • Vogels vliegen in de lucht en kunnen dus lang boven het water vliegen.
  • Mensen zijn intelligent en kunnen daardoor het water lang voor blijven.Zowel ongewervelde als vissen worden door alle lagen heen gevonden, dus die bewering gaat al niet op.
  • Landdieren worden inderdaad in de hogere lagen gevonden, vanaf het Devoon, maar walvissen, zeeschildpadden, pinguïns en Ichtyosauriërs zijn zeedieren, waarom worden die dan weer in hogere lagen, tussen de landdieren gevonden? Verklaarbaar vanuit evolutief perspectief, walvissen en zeeschildpadden stammen immers af van landdieren en leefden ter zelfdertijd als vele andere landdieren.
  • Sommige vogels vliegen ja, maar anderen kunnen alleen lopen, waarom worden die naast de vliegende vogels gevonden? Bovendien worden vliegende vogels aangetroffen vanaf Krijtlagen, en in veel hogere lagen, bijvoorbeeld het Pleistoceen, worden veel grote landdieren aangetroffen zoals mammoeten en neushoorns. Vliegen mammoeten soms hoger dan vogels??
  • Ook de verklaring waarom mensen in hoge lagen worden gevonden loopt spaak, mensen moesten dan wel heel erg intelligent zijn geweest. Want ze hebben ook nog eens alle werktuigen, hutten en alle andere resten van menselijke beschaving tot op het laatst tegen de vloed kunnen beschermen. (Deze worden uitsluitend gevonden in de bovenste aardlagen.),
  • Verder blijkt dat gras en bloemplanten ook ongelooflijk slim moeten zijn geweest. Gras kon bijvoorbeeld veel harder rennen dan de meeste (Lees: alle) dinosauriërs omdat gras namelijk altijd boven de dinosauriërs wordt gevonden in de aardlagen.De feiten houden dus niet veel heel van deze hypothese ……

    Bronnen:

    1 The Marshall illustrated encyclopedia of dinosaurs & prehistoric animals, Cox & Palmer 1988.

    2 Prehistoric life, the rise of the vertebrates, Norman 1994.

    3 Dinosaurs and how they lived, 1987.

    Taxonomy, Transitional Forms, and the Fossil Record

    Precambrian

    Phylum Level Evolution

    Burgess Shale fossils

    Geologic Timeline With Stages

    Valdosta State University/Virtual Museum of Fossils

    10 on-line boek ‘Het ontstaan van de wereld’

    11 Tekortkomingen van de Zondvloedgeologie

    12 Verschillende gesprekken op het Evolutie en/of Creatie forum.

    Fossielen geven een indruk van de biodiversiteit zoals die er in het verleden uitzag .
    a.Waardoor is dit beeld onvolledig ? 
    Fossielen geven een onvolledig beeld van de biodiversiteit in het verleden omdat:
    #
    Harde delen zoals botten, schelpen, hout etc. relatief goed fossiliseren, in tegenstelling tot weke delen zoals spieren en organen; ook van eencellige organismen vindt je maar weinig terug.
    #
    Dode dieren en planten opgegeten worden of vergaan, behalve wanneer ze snel afgedekt worden door een laagje water en/of slib, zoals in veen, moerasgebieden, of door vulkanische as.#
    Organismen die in water leven meer kans hebben om (deels) bewaard te blijven dan op het land.

    In warme streken organismen sneller vergaan dan in een koud klimaat.
    Van veel organismen blijven (vrijwel) geen fossiele resten over.
    Een type fossiel dat maar zelden gevonden wordt is niet noodzakelijkerwijs afkomstig van een organisme dat maar weinig voorkwam of een klein
    verspreidingsgebied had
    b.
    Als een nieuw type fossiel ontdekt wordt probeert men om de mate van verwantschap met reeds bekende fossielen en nu levende soorten vast te stellen. Dat is  vaak moeilijk. 
    Het is vaak moeilijk om de verwantschap tussen fossielen en nu levende organismen vast te stellen omdat doorgaans alleen harde delen (skelet e.d.),
    of afdrukken (bijv. van bladeren) bewaard gebleven zijn.
    Spieren, organen e.d. die een beeld kunnen geven van de leefwijze, fossiliseren niet of nauwelijks.
    Ook DNA is niet( atijd ) meer ( in analyseerbare  vorm ) voorhanden.
    Verwantschap tussen fossielen en levende soorten berust daarom noodzakelijkerwijs voor een belangrijk deel op  vergelijking  van anatomische en morfologische kenmerken.
    Uit vergelijkende DNA studies aan nu levende soorten weten we dat zulke overeenkomsten misleidend kunnen zijn (zie evolutie van katachtigen;). 
    Ook is parallelle evolutie soms lastig te onderscheiden van verwantschap .
    °

    How Rotting Chicken Necks Explain a Long-Standing Paleontology Riddle

    By Sarah Zhang | March 7, 2012 4:12 pm

    spacing is important
    A decaying dinosaur’s increasingly contorted neck

     

    Paleontologists have long wondered by so many fossilized dinosaurs have their necks contorted into painful-looking positions—the phenomenon even has a name: opisthotonus.

    Various hypotheses have suggested the dinosaurs died in pain, or that their unusual posture is from rigor mortis.

     

    °

    http://www.nytimes.com/2012/03/06/science/archaeopteryx-fossils-appear-twisted-but-not-because-of-agony.html?_r=0

    opisthotonus

    opisthotonus

     

    TWISTED Dinosaur fossils are often found with sharply curved necks, but that doesn’t mean that they died in agony.

    An Ornithomimus strikes a pose (Image: Louie Psihoyos/CORBIS)

     

     

     

    °

    °

    Arthropoden gefossiliseerd door versteende aasetende bacterieënhttp://www.geo.uu.nl/ngv/geonieuws/geonieuwsnr.php?nummer=84#523

    Dieren zonder harde bestanddelen worden slechts zelden gefossiliseerd: ze worden verslonden door andere dieren of ze rotten weg onder de invloed van microorganismen.

    Toch komen er dergelijke fossielen voor. Hoe ze kunnen fossiliseren is nu duidelijk, door onderzoek van kleine fossiele arthropoden uit Antarctica, die – net als hun huidige nazaten – geen harde kalkschaal hadden maar slechts een (waarschijnlijk vrij zacht) pantser van chitine.

    Chitine is de stof waaruit ook bijv. onze nagels zijn opgebouwd; het valt uiteen lang voordat een normaal fossilisatieproces begint.


    De Carapace Nunatak op Antartica (South Victoria Land) waar de Kirkpatrick Basalt is ontsloten

    Arthropoden (grootste meet 1 cm) uit meerafzettingen tussen de Kirkpatrick Basalt

    De op Antarctica verzamelde fossiele 180 miljoen jaar oude arthropoden (van de soort Lioestheria disgregaris) werden met een scanning electron microscoop (SEM) onderzocht. Daarbij bleek dat de uitwendige vorm van deze fossielen bewaard was gebleven door een bedekking van miljoenen bolvormige bacteri챘n, die zelf versteend (gesilicificeerd) waren. Dat deze merkwaardige vorm van fossilisatie werd ontdekt, is overigens niet alleen maar toeval: Babcock en zijn medewerkers hielden zich allang bezig met onderzoek naar de fossilisatieomstandigheden van dieren zonder harde schaal of skelet. Daarbij was hun al eerder opgevallen dat dergelijke fossielen vrijwel uitsluitend worden aangetroffen in gesteenten die in een uiterst ongewoon milieu zijn afgezet.

    Sem opname van bacteriën en schimmels die een soort coating vormen van een (alleen zo in vorm bewaarde) arthropode

    Dat was ook hier het geval. Het gesteente waarin de arthropoden werden aangetroffen, moet zijn gevormd in een warmwaterplas. Het water moet ca. 20-30 °C warm zijn geweest; op zichzelf niet zo uitzonderlijk, maar deze plas (of dit meertje) maakte deel uit van een aantal soortgelijke watermassa’s in een vulkanisch gebied; sommige meertjes moeten temperaturen van 80-100 °C hebben gehad. Daarin konden alleen extreme levensvormen overleven, en die werden ook inderdaad aangetroffen: Archaeobacteria (fossiel zeldzaam, en de oudste die ooit op Antarctica zijn gevonden). Het hele gebied was bepaald levenonvriendelijk, en de arthropoden in hun koelere water hadden geen natuurlijke vijanden; ze stierven van ouderdom. Daarop begonnen bacteriën (Eubacteria, die ook nu nog voorkomen) met hun feestmaal. Waarschijnlijk werd toen de plas ingesloten en uiteindelijk afgedekt door een lavapakket. De bacteriën, die de arthropoden volledig bedekten, verkiezelden daarbij.

    Volgens Babcock kan het feit dat fossielen van dieren met uitsluitend relatief zachte delen bijna altijd worden gevonden in extreme afzettingen, erop wijzen dat ze – net als de nu gevonden arthropoden – geen natuurlijke vijanden hadden, een natuurlijke dood stierven, en vervolgens dienden als maaltijd voor bacteri챘n. Of die ook in andere gevallen verantwoordelijk zijn voor de behouden vorm van die ‘zachte’ fossielen, moet overigens nog worden onderzocht.

    Referenties:
    • Babcock, L.E., Rode, A.L., Leslie, S.A., Ford, L.A., Polak, K. & Becker, L., 2004. Microbially mediated precipitation of carbonates and exceptional preservation of fossils in the Kirkpatrick Basalt (Jurassic) of Antarctica. Abstracts 2004 Denver Annual Meeting Geological Society of America (session 204: Biomineralization in terrestrial hot springs: the preservation of thermophiles in past and present-day systems) 204-13, 1 blz.

    Foto’s welwillend ter beschikking gesteld door Loren Babcock, Department of Geological Sciences, Ohio State University, Columbus, OH (Verenigde Staten van Amerika).

     

    °

    Bacteriën bouwen fossielen

    Dat zelfs zachte embryo’s kunnen worden teruggevonden als fossielen, is te danken aan bacteriën.

    24-11-2008

    °

    Een internationale groep onderzoekers onder leiding van de Amerikaanse bioloog Elizabeth Raff gebruikte embryo’s van zeeëgels als proefkonijnen, om te zien hoe fossilisatie in zijn werk gaat.

    Dat gebeurt in drie stappen, schrijven Raff en collega’s in Proceedings of the National Academy of Sciences (PNAS). Allereerst moet het embryo zich in een zuurstofloze omgeving bevinden of daar op de een of andere manier – snel – terechtkomen. De bodem van een meer of zee is bijvoorbeeld een goede plek. Als er wel zuurstof aanwezig is, worden enzymen actief die het levenloze embryo van binnenuit verteren en gaat het hele fossilisatiefeestje niet door.

    Eenmaal dood – maar nog niet verteerd – wordt het embryo rap gekoloniseerd door bacteriën. De microben kruipen de cellen binnen en bedekken alle onderdelen en structuren in die cellen met zogeheten biofilms, dunne laagjes bacteriën die aan elkaar plakken door middel van zelfgemaakt slijm. Uiteindelijk verdwijnt het embryo in de buiken van de bacteriën, maar zijn contouren blijven zichtbaar, dankzij de biofilms.

    Stap drie ten slotte is het proces van mineralisatie. De bacteriën produceren piepkleine kristallen van calciumfosfaat of calciumcarbonaat, waarmee ze de boel verstevigen en de basis leggen voor een nieuw, fossiel embryo.

    Zelfs een zacht, viercellig embryo kan een fossiel worden [Afbeelding: E.C. Raff and R.A. Raff] 

    Et voilà.

     

     

    °

    Remy van den Brande

    GROTE VOORUITGANG PALEONTOLOGIE
    °
    De afgelopen twintig jaar, zijn grote en belangrijke fossiele ontdekkingen gedaan door de paleontologen , met inbegrip van fossielen die de evolutionaire groei en ontwikkeling van walvissen, zeekoeien , zeehonden ____ met inbegrip van hun afstammingsgesciedenissen en verwantschappen met landzoogdieren____ duidelijk aantonen ….
    en die de oorsprong en antecedenten van olifanten, paarden, en rinocerossen duidelijk documenteren .
    °
    Vandaag beschikken we eveneens over een verbazingwekkende diversiteit aan fossiele hominiden , beginnend vanaf rechtoplopende vertegenwoordigers lang voor onze struik grote hersenen ontwikkelde
     en nieuw bewijsmateriaal van moleculaire precisie die wetenschappers toelaten om de boom van het leven te ontcijferen zoals nooit voorheen.
    Het fossielen archief is nu één van de sterkste aanbrengers van bewijsmateriaal voor de feitelijke evolutie..

    Ga naar
    (uitreksel — )
    Het Fossielen archiefHet evolutie-concept wordt ondersteund door de vondsten van fossielen in de rotslagen en afzettingen uit verschillende periodes van de geschiedenis van de Aarde.
    Over het algemeen, worden fossielen die morfologisch goed gelijken op de huidige vormen van het levende , in de jongere rotslagen/afzettingen gevonden , terwijl vele fossielen die slechts oppervlakkig op de huidige biota lijken in de oudere lagen voorkomen. Gebaseerd op dergelijke vaststellingen , stelden de naturalisten voor dat de soorten, veranderen of, in tijd evolueren.
    °
    De natuurlijke selectie is daarbij geïdentificeerd als stuwende kracht achter deze veranderingen.
    Sedertdien hebben de wetenschappers een overweldigend aantal fossielen in rotslagen van verschillende leeftijden gevonden die herhaaldelijk de veranderingen in de levensvormen bevestigen die door de evolutie-theorie worden voorspeld.
    °
    Gansus yumenensis,717a
    Volledig skelet van een overgangsfossiel van een vogel-(Gansus yumenensis )
    dat in China werd ontdekt en in 2006 werd gemeld.
    http://www.carnegiemnh.org/news/06-apr-jun/gansus/changma3_72.jpg
    _
    °
    V Moleculaire biologie , genetica Moleculaire geneticaDNA onderzoek heeft aangegeven hoe de evolutie(- wetenschap moet rekening houden en steunen op mechanismen van , en ) werkt op het moleculaire niveau
    Dit soort vakgenied was onbekend toen de evolutie (en het mechanisme van de natuurlijke selectie) voor het eerst in 1859 werden voorgesteld…De genetica heeft aangetoond dat vertikale overdracht van de(erfelijke) eigenschappen van de ouders aan hun nakomelingen gebeurt dmv DNA: een macromolecule die in alle levende wezens die sleutelfunctie functie vervuld (8!) 
    en tevens de informatie bevat(= het recept) die de celgroei , de celreproductie en de montage en ontwikkeling van organismen (9) , stuurt (samen met de omgeving
    °
    )Vergelijkende DNA studies steunen de bevindingen die werden gevonden in andere takken van de(levens en evolutie)wetenschappen .
    Bijvoorbeeld, vertonen de huidige (= extante) met elkaar vergeleken soorten die verder weg in de geologische tijd ( qua veronderstelde oorsprong of radiatie (10 ) zijn te situeren , grote morfologische verschillen die ook in hun DNA(sequenties/ chromosomen en genomen ) worden weerspiegeld ….
    °
    De graad van verschil geeft een hint over de mogelijke verwantschap …Stambomen (11) die zijn opgesteld op basis van moleculaire vergelijkingen tussen verschillende species ( vooral van hun vergelijkbare ( homologe ) DNA sequenties , genprodukten en aminozuuropeenvolgingen in eiwitten )vallen dikwijls samen met reeds(voorlopige) bekende fossiele stambomen afkomstig uit de paleontologie , de vergelijkende anatomie , de fylogenetica etc (12)


    ——————– A – gorilla GTGCCCATCCAAAAAGTCCA-A GATGACACCAAAACCCTCATCAAGACAATTGTCACCAGG Mens
    GTGCCCATCCAAAAAGTCCAGGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGG Chimp

    ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAA-A-GTCACCGGTTTGGAC Mens
    ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAA-G-GTCACCGGTTTGGAC Chimp
    – – – – – – – – – – – – – – – – – – – – – -G- gorilla

    ———————C- gorilla
    TTCATTCCTGGGCTCCACCC-C-ATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC Mens
    TTCATTCCTGGGCTCCACCC-T-ATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC Chimp

    TACCAACAGATCCTCACCAGTATGCCTTCCAGAAAC-G-TGATCCAAATATCCAACGACCTG Mens
    TACCAACAGATCCTCACCAGTATGCCTTCCAGAAAC-A-TGATCCAAATATCCAACGACCTG Chimp
    – – – – – – – – – – – – – – – – – –A-gorilla

    GAGAACCTCCGGGA-T-CTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG Mens
    GAGAACCTCCGGGA-C-CTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG Chimp
    – – – – – – – -C-gorilla

    Vergelijking bij Mens en Chimpansee van de DNA opeenvolgingen voor het gen dat codeert voor het peptide-hormoon Leptine(betrokken bij het metabolisme van vetten )

    °

    Er zijn slechts vijf plaatsen waar de opeenvolging van de 250 nucleotiden verschillen .

    °

    Daar waar de mens en chimpansee sequenties (= Nucleotiden- opeenvolgingen) verschillen, kan het overeenkomstige ( =homologe ) nucleotide ( op dezelfdelocus in de DNA sesuentie ) in hetzelfde gen bij de gorilla worden gevonden ….

    °

    uit de vergelijking van die drie (mens /chimp /gorilla) kan men het vermoedelijke nucleotide (op die bepaalde plaats) af leiden dat waarschijnlijk in degemeenschappelijke voorvader ( = de “common ancestor” of CA )van mensen, chimpansees, en gorilla’s bestond.

    °

    In twee gevallen, zijn het gorilla en het menselijke nucleotide op die loci gelijk aan elkaar terwijl in de andere drie gevallen, de gorilla en de chimpansee-opeenvolgingen hetzelfde zijn.

    °

    De gemeenschappelijke voorvader van de gorilla, de chimpansee, en de mens zal dus waarschijnlijk het nucleotide hebben dat hetzelfde is in twee van de drie huidige vormen van het gen ; omdat dit enkel één verandering(substitutie ) van een nucleotide op die plaats vergt ipv twee

     


    HAARSCHERPE FOTO’S UIT DE DEELTJESVERSNELLER

    3 maart 2009

     

    Haarscherpe  synchotron foto's

    Haarscherpe synchotron foto’s

     

     

    http://www.nrc.nl/achtergrond/article2069835.ece/Haarscherpe_foto_s_uit_de_deeltjesversneller

    Synchrotrons, ooit ontwikkeld voor deeltjesonderzoek, zijn nu vooral nuttige instrumenten voor medici, biologen en oudheidkundigen.

    Margriet van der Heijden

    °

    Het is druk in het Grand Palais. Buiten, op de Champs Elysées, beginnen auto’s vast te lopen in de avondspits en glimmen de stoepen in de motregen. Binnen lopen oude en jonge Fransen – beschaafd roezemoezend, zoals een mens verwacht in een Groot Paleis – langs een stuk of zeventig stands.

     

    Drie dagen lang presenteren Franse onderzoekers en uitvinders in deze Parijse tentoonstellingshal hun werk. Zo lopen ze vooruit op de Franse ‘wetenschapsweek’, het nationale Fête de la Science van 17 tot 23 november. Paleontoloog Paul Tafforeau staat ergens achterin het hoge en lichte ‘middenschip’ van het paleis. Bij stand nummer 12, over ‘lichtbronnen’. Alleen trekt het oog van de bezoeker naar iets heel anders: naar de mijten, de wespen en de garnaal in de vitrine pal achter Tafforeau. Ze zijn zo’n 30 centimeter lang en gemaakt van zacht wit plastic, als glow-in-the-dark-dieren.

    °

    3D-PRINTER

     

    Nadere inspectie maakt duidelijk: dit zijn geen beesten die van een lopende band afrollen en in de speelgoedwinkel belanden. Daarvoor zijn ze te gedetailleerd, te groot en ook een beetje te vreemd. Deze dieren, verduidelijkt Tafforeau, worden per stuk en laagje voor laagje opgebouwd met een scanner straal

     

    En hier past de lichtbron in zijn verhaal: in dit geval de European Synchrotron Radiation Facility (ESRF).

    Deze supermicroscoop, een instrument van 18 Europese landen, hoort bij de drie grootste synchrotrons op aarde. Hij staat in het Franse Grenoble op de landpunt waar de rivieren de Drac en de Isère samenvloeien. Daar injecteert een krachtige deeltjesversneller elektronen in een ondergrondse opslagring met een omtrek van 844 meter. Dat gebeurt níet om die elektronen daarna op elkaar te laten botsen zoals in het onderzoek naar elementaire deeltjes. In het synchrotron gaat het er om dat elektronen die met sterke magneetvelden op koers worden gehouden, ook altijd intense elektromagnetische straling uitzenden. Van harde röntgenstralen tot zacht infrarood licht. En daaruit filteren onderzoekers uit uiteenlopende disciplines vervolgens licht met een specifieke golflengte, om er voorwerpen en materialen mee te belichten. Als in een supermicroscoop. Met infrarode straling bijvoorbeeld identificeren medici moleculen, om zo de samenstelling van weefsels vast te stellen. Met ultraviolet licht kunnen scheikundigen en farmaceuten onderzoeken of moleculen linksdraaiend of rechtsdraaiend zijn. Met harde röntgenstraling doorgronden kristallografen, archeologen of kunsthistorici het inwendige van allerlei objecten. Het ESRF levert vooral harde röntgenstralen, samengebald in potlooddunne bundels die tienduizend miljard maal intenser zijn dan de bundels uit röntgenapparaten in ziekenhuizen. En met die intense bundels bracht Tafforeau dit voorjaar samen met collega Malvina Lak van de universiteit van Rennes voor het eerst een hele trits insecten en schaaldieren in beeld die honderd miljoen jaar verborgen waren gebleven in ondoorzichtig, matbruin barnsteen (Microscopy and Microanalysis, maart 2008).

    °

    Gereserveerd

    Hij heeft dit verhaal al vaker verteld, zegt Tafforeau, een lange en wat gereserveerde Fransman, die ondanks zijn soepele uitleg zo te zien liever in het lab verblijft dan op een wetenschapsmarkt vol mensen.

    °

    “Ik ben eigenlijk paleo-antropoloog.” Geïnteresseerd in de vroegste mens dus en in zijn evolutionaire voorouders. “En daarom bestudeerde ik tijdens mijn promotieonderzoek aan de universiteit van Montpellier tanden. Van mensachtigen en van primaten.”

    °

    Zo kwam Tafforeau ook bij het ESRF terecht. Min of meer bij toeval, omdat hij in 2000 in een gesprek met José Baruchel van het ESRF zijn frustratie uitte over het feit dat hij de tanden kapot moest maken om hun inwendige goed in kaart te kunnen brengen. En kapotmaken zou bij het synchrotron in Grenoble niet langer nodig zijn, vertelde zijn gesprekspartner. Nu staat een kwart van al het beeldvormende onderzoek bij het ESRF ten dienste van de paleontologie, valt een meeluisterende collega bij de stand in. En Tafforeau, intussen gepromoveerd, heeft de leiding over het bijbehorende paleontologielab, zegt zij ook nog, terwijl Tafforeau een beetje schaapachtig zijn schouders ophaalt. Het voordeel van synchrotronstraling is dat de golven in de röntgenbundel synchroon lopen, met elkaar in de pas, ofwel: in fase. Daardoor kan reliëf in de afbeeldingen worden gebracht, terwijl een gewone röntgenfoto alleen een weerslag van de gemiddelde dichtheid in een object geeft. Het gaat in het synchrotron dus niet om absorptie van de stralen, zoals bij een rechttoe-rechtaan röntgenfoto. Wat telt, is de buiging van röntgenstralen, wanneer ze elektronen passeren die rond de atoomkernen in het materiaal bewegen. De interferentie tussen de synchrone stralen die het materiaal wél ongehinderd passeren en de gebogen stralen zorgt vervolgens voor fasecontrast: het laat zien waar in een object grensvlakken zitten, overgangen van het ene naar het andere materiaal. En dat werkt des te beter, naarmate de bundel beter monochroom (van één golflengte) en synchroon (in de pas lopend) is. Als een voorwerp 1500 keer wordt belicht vanuit verschillende hoeken (één beeld per 0,12 graden), kan zo met behulp van computertechnieken een rijkgedetailleerd driedimensionaal beeld worden opgebouwd, licht Tafforeau een paar dagen later in een email toe.

    °

    Jaarlijks”, schrijft hij verder, “brengen we bij ESRF nu tussen de tweehonderd en duizend objecten uit de paleontologie in kaart. De bijbehorende meettijd per jaar is ongeveer tachtig dagen.”

    °

    Supersynchroon

    “Bovendien kunnen we vrij snel een groot aantal voorwerpen globaal aftasten”, zegt Tafforeau. In het geval van het barnsteen uit de Charentes waren bijvoorbeeld maar vier dagen nodig om uit ruim zeshonderd stukjes barnsteen – samen een paar kilo zwaar – de 350 interessante kandidaten te vissen. Vijftig insecten zijn de afgelopen maanden gedetailleerd en 3D in kaart gebracht. Tafforeau: “Ik schat dat ongeveer 80 procent daarvan uit nieuwe, niet eerder ontdekte soorten bestaat.” Maar ook grotere voorwerpen werden de afgelopen jaren bij het ESRF belicht: een mammoetdijbeen, en de schedel van de waarschijnlijk oudste mensachtige, Sahelanthropus tchadenis bijvoorbeeld. En de groep van Tafforeau onthulde in 2007 ook wat verborgen zat in een dinosaurusei. Al naar gelang de gewenste mate van detail (van 0,28 tot 20 micrometer) gebruiken Tafforeau en collega’s daarvoor röntgenbundels met een doorsnee van 0,5 bij 0,5 millimeter tot 40 bij 15 millimeter. En ja, natuurlijk legt hij ook nog geregeld primatentanden in het harde röntgenlicht, zegt Tafforeau in het Grand Palais. “Ik probeer een derde van mijn tijd te besteden aan onderzoek naar de microstructuur van primatentanden. Eigenlijk komen bijna alle technieken die we nu voor andere fossielen toepassen, voort uit dat werk aan tanden en tandglazuur.” (Zie bijvoorbeeld het Journal of Human Evolution, 28 november 2007) Dan pakt Tafforeau een dertig centimeter lange bij van zacht plastic uit de vitrine en draait hem om en om in zijn handen. “Het speciale”, voegt Tafforeau dan toe, “is trouwens niet per se de ontdekking van nieuwe soorten. Het mooie is vooral dat je een heleboel stukjes steen uit dezelfde tijd en hetzelfde gebied onder de loep kan nemen en daarin heel véél soorten kunt blootleggen. Als we in de toekomst nog sneller kunnen werken, dan kun je met virtuele paleontologie oeroude ecosystemen helemaal in kaart gaan brengen.”

    °

    Synchotrons

    Synchrotrons zijn intense lichtbronnen. Elektronen brengen dat intense licht voort, van röntgenstralen, via uv-licht tot infraroodgolven. De elektronen komen vrij bij het uiteinde van een kathode. Net zoals de kathode in ‘de beeldbuis’ van een ouderwetse televisie produceert die een straal elektronen. De elektronenstraal duikt eerst een lineaire versneller in. Die groepeert de elektronen in pakketjes en versnelt ze ‘voor’ tot een energie van 100 tot 200 mega-elektronvolt. De pakketjes worden daarna geïnjecteerd in een booster – een voorversneller, die de elektronen steeds een zetje geeft. Als hun energie waardes bereikt van 2 tot 6 giga-elektronvolt, afhankelijk van de grootte van het synchrotron, worden de pakketjes geïnjecteerd in een opslagring. Hier, in het feitelijke synchrotron met een omtrek van honderden meters, begint hun werk als lichtproducent. Net als in de grote deeltjesversnellers bij bijvoorbeeld het CERN bij Genève, reizen de elektronen in een synchrotron met relativistische snelheden. Ofwel: als een lichtbundel en een elektronenbundel naar de zon en weer terug zouden reizen, zou het licht slechts met luttele meters voorsprong op aarde arriveren. De technieken in deeltjesversnellers en synchrotrons zijn vrijwel identiek. Ook in synchrotrons houden sterke magneetvelden de elektronen op koers. De elektronen zenden elektromagnetische straling uit wanneer de sterke buigmagneten hen de bocht om – in hun cirkelbaan – sturen. Die straling heeft golflengtes van zachte infrarood- tot harde röntgenstralen. Hoe scherper de bocht, hoe meer energie de elektronen in de vorm van straling verliezen. In deeltjesversnellers vormt deze ‘synchrotronstraling’ een ongewenst energieverlies. In een synchrotron is het de gewenste opbrengst. Het energieverlies van de elektronen wordt in de modernste synchrotrons voortdurend gecompenseerd om continu door te kunnen draaien. Undulatoren met wisselende magneetvelden dwingen de elektronen om onderweg te oscilleren. Dat bewerkstelligt dat de lichtgolven die zij uitzenden, elkaar versterken. Zo neemt de intensiteit van het licht toe tot vele miljarden malen die van zonlicht. Filters selecteren daarna licht van een specifieke golflengte uit dat brede spectrum, en spiegels leiden dat licht naar een van de vaak tientallen bundellijnen. Daar wordt het in meetopstellingen gebruikt om monsters te belichten.

    °

    La petite Sibérie. Zo wordt de vlakte ten zuiden van Parijs genoemd, omdat het er altijd zou waaien of regenen. Twee jaar geleden opende de toenmalige Franse president Jacques Chirac hier Le Soleil – een modern synchrotron (omtrek 354 meter) waar allerlei Franse onderzoekers nu materialen, weefsels, kunstvoorwerpen en moleculen onderzoeken. Le Soleil is een ‘pluridisciplinaire’ onderzoeksinstelling, zeggen de Fransen. En inderdaad: een synchrotron is een meetinstrument ten dienste van een grote verscheidenheid onderzoekers. Zij gebruiken het apparaat niet alleen om het inwendige van monsters in kaart te brengen, zoals in het verhaal hierboven

    °

    Neem Francois le Naour, arts en onderzoeker van het Hôpital Paul Brousse in Villejuif. Hij gebruikt bij Le Soleil infraroodstraling om leverweefsel te bestuderen. Zijn werk is gebaseerd op het feit dat specifieke moleculen op karakteristieke wijze vibreren. Als ze met infraroodstraling worden belicht, absorberen zulke moleculen de infraroodgolven met de energie (en dus de golflengte) die met hun vibratie-energie overeenkomt. Door te meten welke golflengtes in het weefsel geabsorbeerd worden, kan Le Naour zo moleculen identificeren. Met de smalle en zuivere lichtbundel van een synchrotron kan hij zo’n absorptiespectrum zelfs maken voor weefseloppervlakjes van maar 10 bij 10 micrometer – en in het inwendige van cellen kijken. Hij zoekt zo naar een nieuwe diagnostische methode om vroegtijdig steatosis, leververvetting, op te sporen door onverzadigde vetten en esters te identificeren. Aan de overzijde van het Kanaal, in Oxfordshire, staat de Britse tegenhanger van Le Soleil. Dit synchrotron, Diamond (omtrek 561 meter), werd vorig jaar geopend door koningin Elizabeth. Bioloog Andrew Neal ging er bijna meteen aan het werk. Hij gebruikt de röntgenstraling van Diamond om ijzer en zink in tarwekorrels letterlijk op te laten lichten.

     

    Bij deze fluorescentietechniek schiet een röntgenstraal een elektron diep in het ijzer- of zinkatoom weg. De lege plek die achterblijft, wordt daarna opgevuld door elektronen die verder van de atoomkern zitten, onder uitzending van zichtbaar licht. De opnames die Neal maakte, laten eens te meer zien dat bij het bereiden van wit tarwemeel de delen worden verwijderd waarin gezonde elementen als ijzer en zink zitten. De kiem en het schilletje dus.

     

    Maar Neal vindt het vooral belangrijk dat hij het onderzoek naar genetisch aangepaste granen kan versnellen. “We zoeken”, licht hij toe, “naar tarwe met veel hogere en meer over de hele korrel verdeelde concentraties ijzer en zink.

    °

    Zie ook

    http://evodisku.multiply.com/journal/item/70/archaeopteryx_brein

    °

    Insecten
    °
    NIEUWE TECHNIEKEN VAN ONDERZOEK ; SCANS :AMBER en VHR-CT techniek
    °
    Virtuele dissectie
     °
    The University of Texas is the leading institution in X-ray CT.
    There, researchers have created an online database called Digimorph to display more than 300 fossilized and modern specimens. The gallery features Penney’s spider and Wired News’ picks from Digimorph
    °
    Fossiele Spin digitaal(= virtueel) gedissecteerd
    °
    Onderzoekers van de universiteiten van Gent en Manchester zijn erin geslaagd om door middel van X-straalbeeldtechniek een fossiele spin van 53 miljoen jaar oud zeer gedetailleerd te ontleden.
    °
    De spin werd teruggevonden in versteende hars ( Barnsteen /amber ) nabij Parijs.
    Met behulp van de beeldstraaltechniek konden de wetenschappers het beestje van nog geen millimeter groot zo gedetailleerd reconstrueren dat zelfs de ingewanden van de spin zichtbaar zijn.
    °
    Volgens de wetenschappers zal de X-straalbeeldtechniek(=VHR-CT techniek ) een revolutie teweegbrengen in het wereldje van de fossielonderzoekers.
    De spin, een mannetje, kreeg de welluidende naam Cenotextricella simoni mee.
     Cenotextricella simoniCenotextricella simoni 1
    3D images of a 53 million year old male spider which had been preserved in amber. (Credit: Image courtesy of University Of Manchester)
     Credit: David Penney, University of Manchester
    ‘First fossil Micropholcommatidae (Araneae), imaged in Eocene Paris amber using X-Ray Computed Tomography’
    Zootaxa 1623: 47-53.
    Dr David Penney (University Of Manchester (2007, October 30).
    Manuel Dierick, Veerle Cnudde, Bert Masschaele, Jelle Vlassenbroeck, Luc van Hoorebeke , Patric Jacobs RUG – gent
    °

    Kijken in een kop van 300 miljoen jaar

    Nieuwe techniek met röntgenstraling toont vorm van hersenen in oeroude vis

    3 maart 2009

    Alan Pradel van het Muséum National d’Histoire Naturelle in Parijs ontdekte de hersenen toen hij een 300 miljoen jaar oude fossielsteen van de Iniopterygii – uitgestorven verre verwanten van haaien en roggen – afkomstig uit de Amerikaanse staat Kansas onder röntgenstralen hield. Hij kreeg zo informatie over de structuur van de hersenen, de vorm van de hersenholtes en de tussenliggende zenuwen. Via een nieuwe scantechniek – holotomografie – ontwikkeld in de European Synchrotron Radiation Facility (ESRF) in het Franse Grenoble werd een driedimensionaal beeld van de hersenen gevormd. Daarop zagen de onderzoekers dat de hersenen heel klein waren (1,5 bij 7 millimeter) ten opzichte van de schedel. De beelden tonen voorts symmetrische hersenen die met de oogzenuwen verbonden zijn. De langgerekte, fijne voorhersenen zijn volledig vergaan, juist omdat ze zo fragiel zijn. Vroeger keken paleontologen naar de vorm van de schedel om iets te weten te komen over de morfologie van hersenen, want zacht weefsel blijft maar zelden bewaard.

    Boven: Röntgenbeeld van de 300 miljoen jaar oude schedel van een fossiele vis uit Kansas in de VS (groen), met daarin fossiele hersenen (gelig).

    Onder: De versteende schedel van de vis, een Iniopterygium. Beeld: PNAS/Philippe Janvier

    Franse en Amerikaanse onderzoekers laten versteende zachte weefsels zien in een vissenfossiel dat van buiten op een kei lijkt. Nieuwe röntgentechnieken maken dat mogelijk.

    Margriet van der Heijden

    http://www.nrc.nl/wetenschap/article2168487.ece/Kijken_in_een_kop_van_300_miljoen_jaar

    Een vissenbrein. Maar dan van 300 miljoen jaar oud. Dat heeft een team van Franse paleontologen, met collega’s uit New York, zichtbaar gemaakt met de nieuwste technieken. Ze beschrijven de vondst vandaag in de Proceedings of the National Academy of Sciences.

    De onderzoekers stelden de fossiele schedels van Iniopterygii – uitgestorven verre verwanten van haaien en roggen – bloot aan de energierijke röntgenstralen uit de Europese Synchrotron Radiation Facility (ESRF) bij het Franse Grenoble. Uit honderden opnames met die precies afgestelde röntgenbundel maakten zij een driedimensionaal beeld van wat ooit de zachte weefsels binnenin de schedels waren. Zo troffen zij, voor het eerst, de fossiele resten van oeroude vissenhersenen aan.

    „Het bekijken van een fossiel vissenbrein is al heel lang een droom van paleontologen en evolutionair biologen”, zegt dr. Philippe Janvier, aan de telefoon vanuit zijn werkkamer bij het Muséum National de l’Histoire Naturelle in Parijs. Wat zij vooral graag willen zien is het brein van de eerste vissen die ooit aan land kropen, zegt Janvier verder. Zulke vissen spelen een sleutelrol in de evolutie van gewervelde dieren, en uiteindelijk de mens.

    De Iniopterygii behoren niet tot die cruciale soorten. Maar de vondst toont wél aan dat de droom werkelijkheid kan worden, omdat het nu in principe mogelijk is om zulke oude hersenen te ‘zien’.

    Twee jaar geleden bekeek Janvier samen met de promovendus uit zijn groep, Alan Pradel, de allereerste beelden van de fossielen. „Juist die week was er een groot congres in Parijs, waarop de beroemde evolutionair neurobioloog Glenn Northcutt uit Californië een lezing hield. Northcutt zei: ‘Ik zou mijn ziel willen verkopen om het brein te kunnen zien van de eerste vissen die aan land kropen.’ Nog bij de lunch kon ik hem onze resultaten laten zien: een brein, onmiskenbaar.”

    Sindsdien is de techniek – ‘holotomografie’ – verfijnd en zijn de beelden scherper geworden. Ze laten hersenen zien die klein zijn ten opzichte van de schedelholte ( en ze zelfs niet geheel vullen ) .

    Janvier: „Dat is bij vissen niet uitzonderlijk. Je ziet het ook bij de coelacanth, een oeroude soort.”

    De weke en daardoor heel vergankelijke hersenen bleven bewaard doordat de omstandigheden gunstig waren, zegt Janvier.

    „De dode vis is in de modder gevallen en meteen daarna zijn bacteriën in de schedel doorgedrongen. Die hebben zich als een film op de hersenen vastgezet en zo een eerste vorm van bescherming geboden.”

    De kalkachtige stoffen die de bacteriën daarna uitscheidden, vormden een volgend beschermend laagje, legt hij uit. De theorie wordt ondersteund doordat in de hersendelen dichtbij het oppervlak calciumfosfaat is aangetoond.

    De hersenen zijn compleet op één onderdeel na, zegt Janvier. De langgerekte en fijne voorhersenen, die waarschijnlijk zijn vergaan juist omdat ze zo fijn waren.

    Met het blote oog is alleen de versteende schedel zichtbaar. „Wat we hebben gevonden is in zekere zin een ‘fantoombrein’”, zegt Janvier. Een virtuele afbeelding van een structuur die in de steen verborgen zit, bedoelt hij. „En ik heb me natuurlijk voorbereid op kritische collega’s die misschien zullen zeggen dat het een artefact is – iets wat toevallig lijkt op hersenen.”

    Zelf is hij van het tegendeel overtuigd. „Het ziet eruit als hersenen, het zit op de plaats van hersenen en de structuur is zo mooi symmetrisch, zo delicaat en met oogzenuwen verbonden…” Dat kunnen alleen maar hersenen zíjn, bedoelt hij.

    Net een draakvis

    Iniopterygii zijn kraakbeenvissen, net als haaien en roggen. Maar haaien en roggen vallen onder de tak van de Elasmobranchii. De Iniopterygii behoorden tot de vroege Chimaera, een andere tak die zich in het Carboon, tussen 358 en 300 miljoen jaar geleden, op nog wat onduidelijke manier afsplitste. Net als de moderne vertegenwoordigers van die tak, ook wel ‘draakvissen’ genoemd, hadden Iniopterygii ‘borstvinnen’ die dwars op hun rug stonden en bijzonder geplaatste tanden. De hooguit 50 centimeter lange vissen hadden hoornachtige schubben op hun kop. De fossiele schedels die nu in Grenoble onderzocht zijn, kwamen uit de Amerikaanse staten Oklahoma en Kansas.

    http://www.nrc.nl/achtergrond/article2069835.ece/Haarscherpe_foto_s_uit_de_deeltjesversneller

    zie ook ” insekten ”

    Assuming that this object is a mineral replica of the brain and some cranial nerves, it shows an important size discrepancy relative to the endocranial cavity.

    The question of the size and proportions of the brain, relative to the endocranial cav ity been much debated by early vertebrate paleontologists, but anatomical studies of ext ant vertebrates show that the brain generally fills the endocranial cavity and that size discrepancy between the brain and endocranial cavity invoked for some t axa is in fact a consequence of inadequate preservation techniques (10, 20, 21).

    The size discrepancy observed in Sibyrhynchus could be explained by shrinking of the brain tissues that might have occurred just before phosphatization, hence the position of the cerebellum far anterior to the otic capsule (18). Yet the optic tract reaches its foramen in a normal position, as do the other putative cranial nerves, thereby suggesting that the shrinking of the brain was minor.

    CARL ZIMMER

    http://blogs.discovermagazine.com/loom/2009/03/03/like-a-frightened-turtle/

    http://blogs.discovermagazine.com/loom/2009/03/02/the-300-million-year-old-brain-now-in-3-d/

    UGCT
    U(niversity)G(hent) C(enter) T (omography )
    ______________________________________________________________________________________
    docX .   —>  fossil insects
    docX .   –>   vertebraten in amber

    ECHINODERMATA            

    echinodermata 1.docx (3 MB)   <–

Over tsjok45
Gepensioneerd . Improviserend jazzmuzikant . Instant composer. Jamsession fanaat Gentenaar in hart en nieren

One Response to FOSSIELEN

  1. Pingback: ATACAMA walvis massagraf | Tsjok's blog

Geef een reactie

Vul je gegevens in of klik op een icoon om in te loggen.

WordPress.com logo

Je reageert onder je WordPress.com account. Log uit / Bijwerken )

Twitter-afbeelding

Je reageert onder je Twitter account. Log uit / Bijwerken )

Facebook foto

Je reageert onder je Facebook account. Log uit / Bijwerken )

Google+ photo

Je reageert onder je Google+ account. Log uit / Bijwerken )

Verbinden met %s

%d bloggers liken dit: